View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4342-Insertion-2 (Length: 43)
Name: NF4342-Insertion-2
Description: NF4342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4342-Insertion-2 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 43; Significance: 2e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 2e-16
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 3651256 - 3651214
Alignment:
| Q |
1 |
taattttcaccgttgtggttcaagaaatatacgaataatggtg |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3651256 |
taattttcaccgttgtggttcaagaaatatacgaataatggtg |
3651214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University