View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4342_high_5 (Length: 353)
Name: NF4342_high_5
Description: NF4342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4342_high_5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 4 - 353
Target Start/End: Complemental strand, 37662690 - 37662341
Alignment:
| Q |
4 |
ggagaagcagagattgtagcagaaccataaccaaaacttgatgaatctttcagaatcccttcaagaacagaatgcaatgcagttgaaaatgaagaatacc |
103 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37662690 |
ggaggagcaaagattgtagcagaaccataaccaaaacttgatgaatctttcagaatcccttcgagaacagaatgcaatgcagttgaaaatgaagaatacc |
37662591 |
T |
|
| Q |
104 |
cttttgaaccaagtaactgaacaaccttgttccattcaacaaagttcttgaaatcaccaacttcatatgttgaatttgtcttgaatgaaggacaagttgg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
37662590 |
cttttgaaccaagtaactgaacaaccttgttccattcaacaaagttcttgaaatcaccaacttcatatgttgaattggttttgaatgaaggacaagttgg |
37662491 |
T |
|
| Q |
204 |
tgaacgaatgaaatcagaaccaccttgtaaaacttcacgttgcaaagaagaaaaaggtccaagaacaccatgaatgttgaattcttcaccaagaaacata |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37662490 |
tgaacgaatgaaatcagaaccaccttgtaaaacttcacgttgcaaagaagaaaaaggtccaagaacaccatgaatgttgaattcttcaccaagaaacata |
37662391 |
T |
|
| Q |
304 |
tcagggtttgatatcaaaacatggttgatctcaactgttttttgcaaagt |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37662390 |
tcagggtttgatatcaaaacatggttgatctcaactgttttttgcaaagt |
37662341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University