View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4343-Insertion-7 (Length: 319)
Name: NF4343-Insertion-7
Description: NF4343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4343-Insertion-7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 17 - 309
Target Start/End: Complemental strand, 41923261 - 41922969
Alignment:
| Q |
17 |
atgatattgtattctgcactcacatctcatgtttggcaagaaccacctattttagagtttgatggacgtacgtttgtgatgatgattcaaaatttgtaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41923261 |
atgatattgtattctgcactcacatctcatgtttggcaagaaccacctattttagagtttgatggacgtacgtttgtgatgatgattcaaaatttgtaaa |
41923162 |
T |
|
| Q |
117 |
atacccatctaacggacatcaacaaagactaatacgaagttgacaataatatcaattttatttcataagtgagtagccgatgaatactttgcttcccgtg |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41923161 |
atacccatctaacggacatcaacaaggactaatacgaagttgacaataatatcaattttatttcataagtgagtagccgatgaatactttgcttcccgtg |
41923062 |
T |
|
| Q |
217 |
aatatccattgtaatctctactcttaatcctccccgtctccatccctgtcattcttcaacttgttctctctgaaatgagacatctctctctct |
309 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41923061 |
aatatccattgtaatctctactcttaattctccccgtctccatccctgtcatttttcaacttgttctctctgaaatgagacatctctctctct |
41922969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University