View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4343-Insertion-9 (Length: 143)
Name: NF4343-Insertion-9
Description: NF4343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4343-Insertion-9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 3e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 8 - 143
Target Start/End: Complemental strand, 7562768 - 7562633
Alignment:
| Q |
8 |
gatcctgaaggagacggctgggaatctgaaggtggtgatggtggtggtgattgtggtgactcttctggtggagaatctgaaggcgtcgaagaagagttat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7562768 |
gatcctgaaggagacggctgggaatctgaaggtggtgatggtggtggtgattgtggtgactcttctggtggagaatctgaaggcgtcgaagaagagttat |
7562669 |
T |
 |
| Q |
108 |
cagaatcaggaggggaagacattgttcctattcctt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7562668 |
cagaatcaggaggggaagacattgttcctattcctt |
7562633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University