View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4344-Insertion-15 (Length: 171)
Name: NF4344-Insertion-15
Description: NF4344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4344-Insertion-15 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 1e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 1e-85
Query Start/End: Original strand, 8 - 171
Target Start/End: Original strand, 29954645 - 29954808
Alignment:
| Q |
8 |
ctatcctctccaatgtggttgctagatcaattccttgccttatatccctctctcttagctcatatttggaccactctatttcctttgtcatcaaaacttc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29954645 |
ctatcctctccaatgtggttgctagatcaattccttgtcttatatccctctctcttagctcatatttggaccactctatttcctttgtcatcaaaacttc |
29954744 |
T |
 |
| Q |
108 |
aggttcaacaatagtcttgtccttatctctccctacagaactcatagatttccctttaacactg |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29954745 |
aggttcaacaatagtcttgtccttatctctccctacagaactcatagatttccctttaacactg |
29954808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University