View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4344_high_5 (Length: 239)
Name: NF4344_high_5
Description: NF4344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4344_high_5 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 21 - 239
Target Start/End: Original strand, 51108903 - 51109111
Alignment:
| Q |
21 |
aacatattcccaatagcaaagatgacaattttgatagtgttgaaaagagattgtttctaaggaacattcatgcattaaggtttctttgttcataattaag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51108903 |
aacatattcccaatagcaaagatgacaattttgatagtgttg----------gtttctaaggaacattcatgcattaaggtttctttgttcataattaag |
51108992 |
T |
|
| Q |
121 |
ccctagttacaactactagaagtttgtaaattacctgaacgggtgcagcataacacctcacgctgtttaaaacaattggagaaacatttatgggtctagt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51108993 |
ccctagttacaactactagaagtttgtaaattacctgaacgggtgcagcataacacctcacgctgtttaaaacaattggagaaacatttatgggtctagt |
51109092 |
T |
|
| Q |
221 |
attatggaaaagcgaatgc |
239 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
51109093 |
attatggaaaagcgaatgc |
51109111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 199 - 238
Target Start/End: Original strand, 51116634 - 51116673
Alignment:
| Q |
199 |
gagaaacatttatgggtctagtattatggaaaagcgaatg |
238 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51116634 |
gagaaacatttatgggtctagtactatggaaaagcgaatg |
51116673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University