View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4345-Insertion-6 (Length: 159)
Name: NF4345-Insertion-6
Description: NF4345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4345-Insertion-6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 3e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 8 - 159
Target Start/End: Original strand, 42265208 - 42265359
Alignment:
| Q |
8 |
tgatccgctttgattgagtgtcttgtgcctcttgttaattttgttcgtctctggttgttatgtttctcctatttcacttggattagtttggttatgttct |
107 |
Q |
| |
|
||||||||||||||| ||||||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42265208 |
tgatccgctttgattcagtgtctcgtgtctcttgttaattttgttcgtctctgattgttatgtttctcctatttcacttggattagtttggttatgttct |
42265307 |
T |
|
| Q |
108 |
ttttggtggtttcgctttggttcacattggtcttcaatttgttttggtttga |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42265308 |
ttttggtggtttcgctttggttcacattggtcttcaatttgttttggtttga |
42265359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 2e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 20361732 - 20361813
Alignment:
| Q |
19 |
gattgagtgtcttgtgcctcttgttaattttgttcgtctctggttgttatgtttctcctatttcacttggattagtttggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||| ||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
20361732 |
gattgagtgtcttgtgcctcttgtcaattttgtttgtctctagttgttatgtttctcatatttgtgttggattagtttggtt |
20361813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University