View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4345-Insertion-6 (Length: 159)

Name: NF4345-Insertion-6
Description: NF4345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4345-Insertion-6
NF4345-Insertion-6
[»] chr4 (1 HSPs)
chr4 (8-159)||(42265208-42265359)
[»] chr6 (1 HSPs)
chr6 (19-100)||(20361732-20361813)


Alignment Details
Target: chr4 (Bit Score: 136; Significance: 3e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 8 - 159
Target Start/End: Original strand, 42265208 - 42265359
Alignment:
8 tgatccgctttgattgagtgtcttgtgcctcttgttaattttgttcgtctctggttgttatgtttctcctatttcacttggattagtttggttatgttct 107  Q
    ||||||||||||||| ||||||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
42265208 tgatccgctttgattcagtgtctcgtgtctcttgttaattttgttcgtctctgattgttatgtttctcctatttcacttggattagtttggttatgttct 42265307  T
108 ttttggtggtttcgctttggttcacattggtcttcaatttgttttggtttga 159  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
42265308 ttttggtggtttcgctttggttcacattggtcttcaatttgttttggtttga 42265359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 54; Significance: 2e-22; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 20361732 - 20361813
Alignment:
19 gattgagtgtcttgtgcctcttgttaattttgttcgtctctggttgttatgtttctcctatttcacttggattagtttggtt 100  Q
    |||||||||||||||||||||||| ||||||||| |||||| ||||||||||||||| |||||   ||||||||||||||||    
20361732 gattgagtgtcttgtgcctcttgtcaattttgtttgtctctagttgttatgtttctcatatttgtgttggattagtttggtt 20361813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University