View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4345_high_3 (Length: 276)
Name: NF4345_high_3
Description: NF4345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4345_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 27686207 - 27685948
Alignment:
| Q |
1 |
attctttatggctccttcaagcaatgcctattggccaccttcccccggttactggccaagttccaaagtcaggtctatgagcttttataatggttataga |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27686207 |
attctttatggcttcttcaagcaatgcctattggccaccttcccccggttactggccaagttccaaagtcaggtctatgagcttttacaatggttataga |
27686108 |
T |
 |
| Q |
101 |
aacctttggggacctcaacaccaaagcatggatcaacatggaacaactatttggcttgatagaacctcaggtatgaatctgattagtttcaattcacttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27686107 |
aacctttggggacctcaacaccaaagcatggatcaacatggaacaactatttggcttgatagaacctcaggtatgaatctgattagtttcaattcacttt |
27686008 |
T |
 |
| Q |
201 |
agtttagatactttatcgaccggaaaaattacaatggcacgatttgatctcgcaaaattt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
27686007 |
agtttagatactttatcgaccggaaaaattacaatggcacgatttgatttcgcgaaattt |
27685948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 16 - 172
Target Start/End: Original strand, 41268459 - 41268615
Alignment:
| Q |
16 |
ttcaagcaatgcctattggccaccttcccccggttactggccaagttccaaagtcaggtctatgagcttttataatggttatagaaacctttggggacct |
115 |
Q |
| |
|
|||||||||||| |||||||||||||| || || |||||||||||||| || ||| |||||||| |||||| || |||| || ||||| |||||| ||| |
|
|
| T |
41268459 |
ttcaagcaatgcttattggccaccttcacctggctactggccaagttcaaagttcaagtctatgaacttttacaaaggttttacaaaccgttggggccct |
41268558 |
T |
 |
| Q |
116 |
caacaccaaagcatggatcaacatggaacaactatttggcttgatagaacctcaggt |
172 |
Q |
| |
|
||||||||||| | || ||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
41268559 |
caacaccaaagactagaacaaaatgcattaactatttggcttgatagaacctcaggt |
41268615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University