View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4345_low_7 (Length: 239)
Name: NF4345_low_7
Description: NF4345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4345_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 32933669 - 32933547
Alignment:
| Q |
99 |
ccattgaaggaaagtatagtaactaccaactgaaaatatgtgatgtaaataatcatatcatactaactcaaactgttcttatttcatcattacggtttct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
32933669 |
ccattgaaggaaagtatagtaactaccaactgaaaacatgtgatgtaaataatcatatcatactaactcaaacagttcttatttcatcattacagtttct |
32933570 |
T |
|
| Q |
199 |
taatttgatatatatggattaca |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32933569 |
taatttgatatatatggattaca |
32933547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 32933767 - 32933702
Alignment:
| Q |
1 |
ttgaacatgatatgagcatgttaattaatgagaattcagaagaaaattcaaccggaaggatagtca |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32933767 |
ttgaacatgatatgagcatgttaattaatgagaattcagaagaaaattcaaccggaaggatagtca |
32933702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University