View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4346-Insertion-14 (Length: 162)
Name: NF4346-Insertion-14
Description: NF4346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4346-Insertion-14 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 5e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 5e-39
Query Start/End: Original strand, 81 - 162
Target Start/End: Original strand, 17235876 - 17235957
Alignment:
| Q |
81 |
ttgttttgtttgtctctctctcagatgatggatgaagtttgtgttgtgctacgatgatgctgtttgtgtgctgtatatatgc |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17235876 |
ttgttttgtttgtctctctctcagatgatggatgaagtttgtgttgtgctacgatgatgctgtttgtgtgctgtatatatgc |
17235957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 8 - 38
Target Start/End: Original strand, 17235819 - 17235849
Alignment:
| Q |
8 |
ccgtcaaaatcagatccgaatttcagagggt |
38 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17235819 |
ccgtcaaaatcagatccgaatttcagagggt |
17235849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University