View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4346-Insertion-9 (Length: 349)
Name: NF4346-Insertion-9
Description: NF4346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4346-Insertion-9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 8 - 184
Target Start/End: Original strand, 43799151 - 43799327
Alignment:
| Q |
8 |
agcaatgtgggtccggtgaacaaccggaggagctgcttttgtgtgacaaatgtgacaatggttttcatatgaaatgtgtcagaccaattgttgttcgagt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43799151 |
agcaatgtgggtccggtgaacaaccggaggagctgcttttgtgtgacaaatgtgacaatggttttcatatgaaatgtgtcagaccaattgttgttcgagt |
43799250 |
T |
|
| Q |
108 |
tccgattggtccgtggatttgccccaagtgttctgatgtgaaggtcaagaaactcaaaagtaagagattgaaattgt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43799251 |
tccgattggtccgtggatttgccccaagtgttctgatgtgaaggtcaagaaactcaaaagtaagagattgaaattgt |
43799327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 275 - 349
Target Start/End: Original strand, 43799413 - 43799487
Alignment:
| Q |
275 |
tacagagctttctcagaagaaaattcttgatttcttcgggcttcgtagggattctcttttcgggaacaatcgtgc |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43799413 |
tacagagctttctcagaagaaaattcttgatttcttcgggcttcgtagggattctcttttcgggaacaatcgtgc |
43799487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 12 - 139
Target Start/End: Original strand, 43794330 - 43794457
Alignment:
| Q |
12 |
atgtgggtccggtgaacaaccggaggagctgcttttgtgtgacaaatgtgacaatggttttcatatgaaatgtgtcagaccaattgttgttcgagttccg |
111 |
Q |
| |
|
|||||| || ||||||||||| |||||||| | |||||||||||||| ||||| |||||||||||||| ||| | ||||| ||| | | | ||||||| |
|
|
| T |
43794330 |
atgtggatctggtgaacaacctgaggagcttttgttgtgtgacaaatgcgacaaaggttttcatatgaagtgtctgagaccgattctggctagagttcct |
43794429 |
T |
|
| Q |
112 |
attggtccgtggatttgccccaagtgtt |
139 |
Q |
| |
|
|||||| | ||||||||||||||||||| |
|
|
| T |
43794430 |
attggttcatggatttgccccaagtgtt |
43794457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University