View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4346_high_10 (Length: 236)
Name: NF4346_high_10
Description: NF4346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4346_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 26106246 - 26106466
Alignment:
| Q |
1 |
ttgactaccaatcaatattgatggatatgtttttccaatcatatattttt--ccatcaacaaggttcaacccgagactttattgaaaggatccgaccaat |
98 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| ||| |||| ||||||| ||||||||||| |
|
|
| T |
26106246 |
ttgactaccgatcaatattgatggatatgtttttccaatcatatttttttttccatcaacaaggttcaacgcga--ctttgttgaaagaatccgaccaat |
26106343 |
T |
 |
| Q |
99 |
tttgatggatatgtttttcccactcggataatataatgttggtcatcatgatgtcattcatttgattgtatcatgtgaaattaatctcatttactaatta |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26106344 |
tttgatggatatgtttttcccactcggataatataatgttggtcatcatgatgtcattcatttgattgtatcatgtgaaattaatctcattaactaatta |
26106443 |
T |
 |
| Q |
199 |
attgggaaagtagaacttgtttc |
221 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
26106444 |
attggaaaagtagaacttgtttc |
26106466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University