View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4346_low_14 (Length: 210)
Name: NF4346_low_14
Description: NF4346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4346_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 83 - 196
Target Start/End: Complemental strand, 43109782 - 43109669
Alignment:
| Q |
83 |
ctatagtcaaatcattcatttcgttgtaccnnnnnnnnnnnntatgtcatatctgtttaaaatttgagaagatatcaagtattaacttggtgatgaaaat |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43109782 |
ctatagtcaaatcattcatttcgttgtaccaaaaaacaaaaatatgtcatatctgtttaaaatttgagaagatatcaagtattaatttggtgatgaaaat |
43109683 |
T |
 |
| Q |
183 |
ggtacaaagatttt |
196 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43109682 |
ggtacaaagatttt |
43109669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University