View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4347-Insertion-13 (Length: 211)
Name: NF4347-Insertion-13
Description: NF4347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4347-Insertion-13 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 211
Target Start/End: Original strand, 32471915 - 32472118
Alignment:
| Q |
8 |
ccttcactatctttcaaataccctaacataacacaaccacctctcataacaacttcaccaagcgttgcaccatcacgttttacactttcaccacttggac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32471915 |
ccttcactatctttcaaataccctaacataacacaaccacctctcataacaacttcaccaagcgttgcaccatcacgttttacactttcaccacttggac |
32472014 |
T |
|
| Q |
108 |
ccaccacatcaacctttgtcatccctagggttctcactccttgccgtgacttcaaccttgctctctccgtcgccggtaacaaattccatttcttcttcca |
207 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32472015 |
ccactacatcaacctttgtcatccctagggttctcactccttgccgtgacttcaaccttgctctctccgtcgccggtaacaaattccatttcttcttcca |
32472114 |
T |
|
| Q |
208 |
tgta |
211 |
Q |
| |
|
|||| |
|
|
| T |
32472115 |
tgta |
32472118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 183
Target Start/End: Complemental strand, 32464945 - 32464778
Alignment:
| Q |
16 |
atctttcaaataccctaacataacacaaccacctctcataacaacttcaccaagcgttgcaccatcacgttttacactttcaccacttggacccaccaca |
115 |
Q |
| |
|
|||||| ||||| || | |||||||||| ||||| | | ||| | |||||||| |||| |||||||| ||||||||||||||| | || || |||||| |
|
|
| T |
32464945 |
atcttttaaataaccaagcataacacaagcaccttttacaacgatttcaccaaccgttacaccatcattctttacactttcaccagtgggtccgaccaca |
32464846 |
T |
|
| Q |
116 |
tcaacctttgtcatccctagggttctcactccttgccgtgacttcaaccttgctctctccgtcgccgg |
183 |
Q |
| |
|
||||||| | || ||| | | ||||| ||||||| || ||||| ||| || |||||||||||||| |
|
|
| T |
32464845 |
tcaacctccgccacccccaccctcctcacaccttgccttgccttcatcctcgccctctccgtcgccgg |
32464778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University