View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4347-Insertion-15 (Length: 105)
Name: NF4347-Insertion-15
Description: NF4347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4347-Insertion-15 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 1e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 6 - 105
Target Start/End: Complemental strand, 54302735 - 54302636
Alignment:
| Q |
6 |
catattatcactacggcagctgattgtttttggagtgcatcaaatgatgaagacatttctgaactcaaatcaatttgaaaattggaaataatttattttc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54302735 |
catattatcactacggcagctgattgtttttggagtgcatcaaatgatgaagacatttcttaactcaaatcaatttgaaaattggaaataatttattttc |
54302636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University