View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4347_low_10 (Length: 236)
Name: NF4347_low_10
Description: NF4347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4347_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 25 - 193
Target Start/End: Original strand, 5969100 - 5969268
Alignment:
| Q |
25 |
attaagccataactcgtggagccagaaaccatacattttacatttatactctaatgtcctttaagataaccttatctgacacacacttgtctgtatatca |
124 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5969100 |
attaagccataactcgtggagccagaatccatacattttacatttatactctaatgtcctttaagataaccttatctgacacacacttgtctgtatatca |
5969199 |
T |
 |
| Q |
125 |
catattagaaatcacatgcctaactttgactattagcctgcgttacagttttgggacaatctatagtgc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5969200 |
catattagaaatcacatgcctaactttgactattagcctgcgttacagttttgggacaatctatagtgc |
5969268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University