View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4349-Insertion-8 (Length: 120)
Name: NF4349-Insertion-8
Description: NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4349-Insertion-8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 7 - 116
Target Start/End: Original strand, 2295444 - 2295553
Alignment:
| Q |
7 |
atgaccaatattttttctcttcaaattaatcttcctcaaatgttgcttcatttgtgatatgtttctaaatttgtttggttttctattttatttgtgttta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2295444 |
atgaccaatattttttctcttcaaattaatcttcctcaaatgttgcttcatttatgatatgtttctaaatttgtttggttttctattttatttgtgttta |
2295543 |
T |
|
| Q |
107 |
ggaaaattgg |
116 |
Q |
| |
|
|||||||||| |
|
|
| T |
2295544 |
ggaaaattgg |
2295553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University