View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4352-Insertion-7 (Length: 157)
Name: NF4352-Insertion-7
Description: NF4352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4352-Insertion-7 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 4e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 4e-70
Query Start/End: Original strand, 8 - 157
Target Start/End: Complemental strand, 980000 - 979851
Alignment:
| Q |
8 |
caaggtagtcaaaatcacgattaaaagcgtaaaaacgtacgattttacaattatgctggccctcaacgattttggtgataagcataatcggaagatggtg |
107 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
980000 |
caaggtagtcaaaatcacaattaaaagcataaaaacgtacgattttacaattatgctggcccttaacgattttggtgataagcataatcggaagatggtg |
979901 |
T |
 |
| Q |
108 |
gaatcgggtggaatcgccatcaataattgtaaaatcgtggatgtgattga |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
979900 |
gaatcgggtggaatcgccatcaataattgtaaaatcgtggaagtgattga |
979851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University