View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4354-Insertion-14 (Length: 262)
Name: NF4354-Insertion-14
Description: NF4354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4354-Insertion-14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 40 - 211
Target Start/End: Complemental strand, 33308917 - 33308746
Alignment:
| Q |
40 |
ttcctagtctcctcatgtagtgttagaaaaagctcttcgttacgagctttcgaaatgagccaacaagcaatcaaaaagagttgtccatcttgctcggaag |
139 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||| | ||||||| |||| |||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
33308917 |
ttcctagtctccccatgtagtgttagaaaaaactcttcgttacaaactttcgatatgaaccaacaagcaatcaaaaatagttgttcatcttgctcggaag |
33308818 |
T |
 |
| Q |
140 |
caaattgattaattgaattataacatttagacatcataaagatttaagaattatgaaaatacaacgtattcc |
211 |
Q |
| |
|
|||| |||||||| |||| |||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33308817 |
caaaatgattaatcgaatcataacatttaaacatcgtaaagatttaagaattatgaaaatacaacgtattcc |
33308746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University