View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4354_high_1 (Length: 239)
Name: NF4354_high_1
Description: NF4354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4354_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 19 - 228
Target Start/End: Complemental strand, 295244 - 295035
Alignment:
| Q |
19 |
acttaagcatcgaacatcaacaatctgtttcttctgtcccttaaaacctacaaatgtttctttcttaactaacacaaaccgtgtcaataccaacactaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
295244 |
acttaagcatcgaacatcaacaatctgtttcttctgtcccttaaaacctacaaatgtttctttcttaactaacacaaaccgtgtcaataccaacactaca |
295145 |
T |
 |
| Q |
119 |
aagtgtaatgcattttttgataataatgtcaccagtggtttgttggaggttggtgggggccacattccttctttccttcgatcaggactacttcagtttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
295144 |
aagtgtaatgcattttttgataataatgtcaccagtggtttgttggaggttggtggggaccacattccttctttccttcgatcaggactacttcagtttc |
295045 |
T |
 |
| Q |
219 |
aagaattatc |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
295044 |
aagaattatc |
295035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University