View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4354_low_2 (Length: 233)
Name: NF4354_low_2
Description: NF4354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4354_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 15 - 131
Target Start/End: Complemental strand, 5830548 - 5830432
Alignment:
| Q |
15 |
caactgctgcatacttctaatgatcacagggctgcatttttcgctacattaatttggagtattttgaaacatataaaaaccaaattatggaatacttcaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5830548 |
caactgctgcatacttctaatgatcacagggcagcattttttgctacattaatttggagtattttgaaacatataaaaaccaaatcatggaatacttcaa |
5830449 |
T |
|
| Q |
115 |
cagggcagaacaatttt |
131 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5830448 |
cagggcagaacaatttt |
5830432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University