View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4354_low_3 (Length: 207)
Name: NF4354_low_3
Description: NF4354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4354_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 45341409 - 45341475
Alignment:
| Q |
1 |
tactgctcatgcgccagtgcaattcatcaatgaaaagaaacaactcatttactaatattgtgaagtt |
67 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45341409 |
tactgctcatgtgccagtgcaattcatcaatgaaaagaaacaactcatttactaatattgtgaagtt |
45341475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 168 - 207
Target Start/End: Original strand, 45341577 - 45341616
Alignment:
| Q |
168 |
atgtgtgaaaggtcacacagaaatgaactataacaacaaa |
207 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
45341577 |
atgtgtgaaaggtcacacggaaattaactataacaacaaa |
45341616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University