View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4355_high_1 (Length: 307)
Name: NF4355_high_1
Description: NF4355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4355_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 155 - 291
Target Start/End: Original strand, 27526542 - 27526678
Alignment:
| Q |
155 |
aactactaatataacttctaaccactaatatttgtcggtagaaaaatacagtaaccaccataagcaatcataaaccatcttattattactatggcttata |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27526542 |
aactactaatataacttctaaccactaatatttgtcagtagaaaaatacactaaccaccataagcaatcataaaccatcttattattactatggcttata |
27526641 |
T |
 |
| Q |
255 |
ttggcctctcgtcacaaagccaaccaatggtatgtat |
291 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27526642 |
ttggcctctcgtcacaatgccaaccaatggtatgtat |
27526678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 15 - 123
Target Start/End: Original strand, 27514950 - 27515058
Alignment:
| Q |
15 |
actcaatgatgttcttgatgtaatttgagtcaccggggcatatttcgaattgttgatatatggccataagagtatgagaatgaggtttaaggctcaaatt |
114 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
27514950 |
actcactgatgttcttgatgtaatttgagtcaccggggcatattttgaattgttgatatatggccagaagagtatgagaatgaggtttaaggctcaaact |
27515049 |
T |
 |
| Q |
115 |
ataactact |
123 |
Q |
| |
|
||||||||| |
|
|
| T |
27515050 |
ataactact |
27515058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University