View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4357_high_11 (Length: 249)
Name: NF4357_high_11
Description: NF4357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4357_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 177
Target Start/End: Complemental strand, 32531737 - 32531578
Alignment:
| Q |
18 |
tgacataggtggaagtggaagcacttgtaattcaaggacctaaactggccacagtgatgagccaggtaaagaaattggaggtctctatcctggtacttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32531737 |
tgacataggtggaagtggaagcacttgtaattcaaggacctaaactggccacagtgatgagccaggtaaagaaattggaggtctctatcctggtacttgg |
32531638 |
T |
 |
| Q |
118 |
ccaaaagaagccatcttctttctttagctggtaagagtcctatcatccaaacacaagcaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32531637 |
ccaaaagaagccatcttctttctttagctggtaagagtcctatcatccaaacacaagcaa |
32531578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 177 - 249
Target Start/End: Complemental strand, 32531550 - 32531478
Alignment:
| Q |
177 |
aagtgtatagagcttgaacttgtaaacagagttcaaatcctctaattgacaatagtaaattgaattaatctct |
249 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32531550 |
aagtgtatagagcttgaaattgtaaacagagttcaaatcctctaattgacaatagtaaattgaattaatctct |
32531478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University