View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4357_low_10 (Length: 250)
Name: NF4357_low_10
Description: NF4357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4357_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 8167577 - 8167816
Alignment:
| Q |
1 |
ccctagtttgcgttttgagaaggaatcgcggggcttgtttgattgttctgctttcttgattttaatggtt---ctcttacgtttgttgttgctttttgtt |
97 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8167577 |
ccctagtttgcgttttgagaaggtatcgaggggcttgtttgattgttctgctttcttgattttaatggttgatctcttacgtttgttgttgctttttgtt |
8167676 |
T |
 |
| Q |
98 |
gatgtgttgtttccgtctgaagaagccattggatctttcttccaagaggagaaagagggaagaaagaactcaataaccaaatatgaaagaaaactttgtt |
197 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8167677 |
gatgtgttgtttccgtttgaagaagccattggatctttcttccaagaggagaaagagggaagaaagaactcaataaccaaatatgaaagaaaactttgtt |
8167776 |
T |
 |
| Q |
198 |
ttgttcccaaaatatggaactgactctttcttttttagaa |
237 |
Q |
| |
|
||| |||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
8167777 |
ttggtcccaaaatatggaaccgactctttcttttatagaa |
8167816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 2 - 145
Target Start/End: Original strand, 50707645 - 50707789
Alignment:
| Q |
2 |
cctagtttgcgttttgagaaggaatcgcggggcttgtttgattgttctgctttcttgattttaatggttctcttacgtttgttgttgctttttgttgatg |
101 |
Q |
| |
|
||||||||||| ||||| |||| ||| || ||||||| ||| | | |||||||||||||| ||||||| |||| ||| |||| | | ||||||||| | |
|
|
| T |
50707645 |
cctagtttgcgctttgaaaaggtatcacgccgcttgttcgatggctttgctttcttgatttcaatggttttcttccgtgagttgcttcgttttgttgacg |
50707744 |
T |
 |
| Q |
102 |
tgttgtttccgtctg-aagaagccattggatctttcttccaagag |
145 |
Q |
| |
|
|||||||||| || | |||||||||||| |||||||||||||||| |
|
|
| T |
50707745 |
tgttgtttccatccgtaagaagccattgaatctttcttccaagag |
50707789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University