View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4358-Insertion-4 (Length: 335)
Name: NF4358-Insertion-4
Description: NF4358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4358-Insertion-4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 8 - 292
Target Start/End: Complemental strand, 41959951 - 41959663
Alignment:
| Q |
8 |
aattaaaggtatgatataactagaagtatctcattcaatatttgttcactaacataattgaannnnnnnngttgctatgaaccattaagttatgtaacca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41959951 |
aattaaaggtatgatataactagaagtatctcattcattatttgttcactaacataattgaattttttttgttgctatgaaccattaagttatgtaacca |
41959852 |
T |
 |
| Q |
108 |
tgtgctaatgatttat----atgaataatgtgacagggtcgtgaacggttgaacgggaaacccttgtatgtgttaatcaaatgttttgagtgttgtgact |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41959851 |
tgtgctaatgatttatttatatgaataatgtgacagggtcgtgaacggttgaacgggaaacccttgtatgtgttaatcgaatgttttgagtgttgtgact |
41959752 |
T |
 |
| Q |
204 |
ctcaaaagatgaaagaagaaaatgaatgattggtcactctcaacattggtgctttctcaattggaattccattttattcatatccctcc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41959751 |
ctcaaaagatgaaagaagaaaatgaatgattggtcactctcaacattggtgctttctcaattggaattccattttattcatctccctcc |
41959663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University