View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4358-Insertion-7 (Length: 128)
Name: NF4358-Insertion-7
Description: NF4358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4358-Insertion-7 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 2e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 8 - 128
Target Start/End: Complemental strand, 41350793 - 41350673
Alignment:
| Q |
8 |
aggccgtctttgtcgagatgccaaatgcaacggcgtcgcaccctttccatctctaacattcacaaaccgaacaaatcccctacaaccaattcaagaacat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41350793 |
aggccgtctttgtcgagatgccaaatgcaacggcgtcgcaccctttccatctctaacattcacaaaccgaacaaatcccctacaaccaattcaagaacat |
41350694 |
T |
 |
| Q |
108 |
ttaaaaaaccataacaacata |
128 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41350693 |
ttaaaaaaccataacaacata |
41350673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.0000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 8 - 76
Target Start/End: Complemental strand, 23713064 - 23712996
Alignment:
| Q |
8 |
aggccgtctttgtcgagatgccaaatgcaacggcgtcgcaccctttccatctctaacattcacaaaccg |
76 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| || ||||| | || ||||||| |||||||||||| |
|
|
| T |
23713064 |
aggccgtctttgacgagctgccaaatgcaacggtgtagcacctctaccgtctctaatattcacaaaccg |
23712996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University