View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4359_low_6 (Length: 239)
Name: NF4359_low_6
Description: NF4359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4359_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 45673479 - 45673714
Alignment:
| Q |
1 |
aatgaaacatacaccaacgtatagagataactgacagatagattcccttgccactttattcattccttataattcctactaataattaaatcacctttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45673479 |
aatgaaacatacaccaacgtatagagataactgacagatagattcccttgccactttattcattccttataattcctactaataattaaatcacctttcc |
45673578 |
T |
 |
| Q |
101 |
tgcaatccaatccttcttaaactttgatttatgcccaaattaacctttataaaatcatttaggatgaatattgtctcccatttataatt-tttaaatgtg |
199 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
45673579 |
tgcaatccaatccttcttaaagtttgatttatgcccaaattaacctttataaaatcatttaggatgaatattgtctcccatttataattataaaaatgtg |
45673678 |
T |
 |
| Q |
200 |
tttggattggatgtgagattcttaaatattagacat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45673679 |
tttggattggatgtgagattcttaaatattagacat |
45673714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University