View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4360-Insertion-13 (Length: 290)
Name: NF4360-Insertion-13
Description: NF4360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4360-Insertion-13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 11)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 84 - 153
Target Start/End: Complemental strand, 30747880 - 30747811
Alignment:
| Q |
84 |
gacgaagtcttttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgata |
153 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30747880 |
gacgaagtcttttagagtggaggaagcgacaatgggtccagtagtggtatcgaggattgcgattttgata |
30747811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 90 - 186
Target Start/End: Complemental strand, 29870468 - 29870372
Alignment:
| Q |
90 |
gtcttttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgatagtcatggcattggtcggagctccgtgcccatta |
186 |
Q |
| |
|
|||||||||||||||||| ||||||| | ||||||| ||||||||||||||||||||||||||||| | ||| | |||| ||||| ||||||||||| |
|
|
| T |
29870468 |
gtcttttggagtggaggaggtgacaacgagtccggtggtggtatcgaggattgcgattttgatagtgagggcgtgggtcagagctgcgtgcccatta |
29870372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 90 - 186
Target Start/End: Complemental strand, 29851577 - 29851485
Alignment:
| Q |
90 |
gtcttttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgatagtcatggcattggtcggagctccgtgcccatta |
186 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||| |
|
|
| T |
29851577 |
gtcttttggagtggaggagatgacaataagtccggtggtggtatcgaggattgcgattttgatagtcagggc----gtcggagctctgtgcccatta |
29851485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 91 - 152
Target Start/End: Original strand, 30244267 - 30244328
Alignment:
| Q |
91 |
tcttttggagtggaggaagtgacaatgggtccggtagtggtatcgaggattgcgattttgat |
152 |
Q |
| |
|
||||||||||||||||| ||||||| | |||| || |||| ||||||||||||||||||||| |
|
|
| T |
30244267 |
tcttttggagtggaggaggtgacaacgagtccagtcgtggcatcgaggattgcgattttgat |
30244328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 129 - 199
Target Start/End: Complemental strand, 30398633 - 30398564
Alignment:
| Q |
129 |
ggtatcgaggattgcgattttgatagtcatggcattggtcggagctccgtgcccattaacaaagtctgatc |
199 |
Q |
| |
|
||||||||||||||||||||||| | || ||||| ||||||||||| |||||||||| | |||||||||| |
|
|
| T |
30398633 |
ggtatcgaggattgcgattttgacaatcggggcatgggtcggagctctgtgcccattagc-aagtctgatc |
30398564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 53
Target Start/End: Complemental strand, 29870737 - 29870704
Alignment:
| Q |
20 |
tgtttggatttcaactgctcaaaaatctttattt |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29870737 |
tgtttggatttcaactgctcaaaaatctttattt |
29870704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 53
Target Start/End: Complemental strand, 30058848 - 30058815
Alignment:
| Q |
20 |
tgtttggatttcaactgctcaaaaatctttattt |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30058848 |
tgtttggatttcaactgctcaaaaatctttattt |
30058815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 84 - 121
Target Start/End: Complemental strand, 30481585 - 30481548
Alignment:
| Q |
84 |
gacgaagtcttttggagtggaggaagtgacaatgggtc |
121 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30481585 |
gacgcagtcttttggagtggaggaagtgacaatgggtc |
30481548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 53
Target Start/End: Complemental strand, 30481883 - 30481850
Alignment:
| Q |
20 |
tgtttggatttcaactgctcaaaaatctttattt |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30481883 |
tgtttggatttcaactgctcaaaaatctttattt |
30481850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 53
Target Start/End: Original strand, 30678795 - 30678828
Alignment:
| Q |
20 |
tgtttggatttcaactgctcaaaaatctttattt |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30678795 |
tgtttggatttcaactgctcaaaaatctttattt |
30678828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 53
Target Start/End: Original strand, 30714638 - 30714671
Alignment:
| Q |
20 |
tgtttggatttcaactgctcaaaaatctttattt |
53 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
30714638 |
tgtttgcatttcaactgctcaaaaatctttattt |
30714671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University