View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4361-Insertion-6 (Length: 273)
Name: NF4361-Insertion-6
Description: NF4361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4361-Insertion-6 |
 |  |
|
| [»] chr3 (78 HSPs) |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0057 (4 HSPs) |
 |  |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0954 (1 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0167 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0867 (1 HSPs) |
 |  |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 78)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 10 - 273
Target Start/End: Original strand, 39203538 - 39203801
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39203538 |
aaaggtcacaggttcaagtccttgaaacagcctcttgtgtaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccttgca |
39203637 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgccctttaatgtatagtttctctctagagttccgaaacagttaattttggttgaaattctcaatgaattagtt |
209 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39203638 |
tatgcgggagctttagtgcaccgggttgccctttaatgtatagtttctctctagagttccgaaacagttaattttggttgaaattctcaatgaattagtt |
39203737 |
T |
 |
| Q |
210 |
tatcttcatgaaaacttatagaaacaaacagcttatgcaaaagttatttatgtttaccctcctt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39203738 |
tatcttcatgaaaacttatagaaacaaacagcttatacaaaagttatttatgtttaccctcctt |
39203801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 1217112 - 1217245
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1217112 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggcgggaccccttcccggaccctgca |
1217211 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1217212 |
tatgcgggagctctagtgcaccgggttgcccttt |
1217245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 17 - 143
Target Start/End: Original strand, 31592878 - 31593004
Alignment:
| Q |
17 |
acgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgg |
116 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31592878 |
acgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggactccttcccggaccctgcatatgcgg |
31592977 |
T |
 |
| Q |
117 |
gagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31592978 |
gagctctagtgcaccgggttgcccttt |
31593004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 10 - 142
Target Start/End: Complemental strand, 22123050 - 22122918
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||| ||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22123050 |
aaaggtcgcgggttcaagtcctggaaacagtctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
22122951 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
22122950 |
tatgcgagagctctagtgcaccgggttgccctt |
22122918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 13628927 - 13628790
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa--aacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13628927 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccc |
13628828 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
13628827 |
tgcgtatgcgggagctttagtgcaccgggttgcccttt |
13628790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 40272946 - 40272812
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||| |||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40272946 |
aaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
40272847 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
40272846 |
gtatgcgggagctttagtgcaccgggttgcccttt |
40272812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 37 - 143
Target Start/End: Original strand, 15797271 - 15797377
Alignment:
| Q |
37 |
cagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggtt |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15797271 |
cagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggtt |
15797370 |
T |
 |
| Q |
137 |
gcccttt |
143 |
Q |
| |
|
||||||| |
|
|
| T |
15797371 |
gcccttt |
15797377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 13730738 - 13730602
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13730738 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggacccc |
13730639 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13730638 |
gcatatgcgggagctttagtgcaccgggttgcccttt |
13730602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 11 - 142
Target Start/End: Original strand, 22609789 - 22609921
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||| ||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
22609789 |
aaggtaacgggttcaagtcttggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcg |
22609888 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |
|
|
| T |
22609889 |
tatgcgggagcttcagtgcaccgggttgccctt |
22609921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 8 - 142
Target Start/End: Complemental strand, 7697022 - 7696893
Alignment:
| Q |
8 |
taaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
7697022 |
taaaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatgg-----ccccttcccggacactg |
7696928 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||| |
|
|
| T |
7696927 |
catatgtgggagctctagtgcaccgggtttccctt |
7696893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 26869729 - 26869863
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
26869729 |
aaaggtcacaggttcaagtcctggaaacagcctctggtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttgccggaccatgc |
26869828 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| |
|
|
| T |
26869829 |
gtatgcgggagctttggtgcaccgggttgcccttt |
26869863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 8 - 143
Target Start/End: Complemental strand, 29366859 - 29366720
Alignment:
| Q |
8 |
taaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggac |
103 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29366859 |
taaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggac |
29366760 |
T |
 |
| Q |
104 |
cctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||| |||| ||||||| |||||||| |||||||||||| |
|
|
| T |
29366759 |
cctgcgtatgtgggagctttagtgcactgggttgcccttt |
29366720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 46 - 143
Target Start/End: Complemental strand, 34771461 - 34771364
Alignment:
| Q |
46 |
gtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34771461 |
gtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgcccttt |
34771364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 46421172 - 46421034
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46421172 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccc |
46421073 |
T |
 |
| Q |
106 |
tgcatatgcgggagctct-agtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| |||||||||||| | |||||||||| ||||||||| |
|
|
| T |
46421072 |
tgcgtatgcgggagctttaagtgcaccggtttgcccttt |
46421034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 12914170 - 12914035
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
12914170 |
aaaggtcacaagttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggcggcgtacaatacaccaaatggtgagaccccttcccagaccctg |
12914071 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| |
|
|
| T |
12914070 |
catatgcgggagcttcaatgcaccgggttgcccttt |
12914035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 28 - 143
Target Start/End: Original strand, 54484730 - 54484848
Alignment:
| Q |
28 |
tcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctcta |
124 |
Q |
| |
|
||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
54484730 |
tcctggaaacagcctcttgtgtaaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttta |
54484829 |
T |
 |
| Q |
125 |
gtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
54484830 |
gtgcaccgggttgcccttt |
54484848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 16 - 144
Target Start/End: Complemental strand, 10795554 - 10795422
Alignment:
| Q |
16 |
cacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcata |
111 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| || |
|
|
| T |
10795554 |
cacgggttcaagtcctggaaacagcctcttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgta |
10795455 |
T |
 |
| Q |
112 |
tgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| |
|
|
| T |
10795454 |
tgcgggagcttcagtgcaccaggttgcccttta |
10795422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 14 - 143
Target Start/End: Original strand, 16735467 - 16735597
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgt-gtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatat |
112 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
16735467 |
gtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacactgcgtat |
16735566 |
T |
 |
| Q |
113 |
gcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||| |||| ||||||| |||||||||||| |
|
|
| T |
16735567 |
gcggtagcttcagtgcactgggttgcccttt |
16735597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 10 - 141
Target Start/End: Original strand, 26573149 - 26573282
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
26573149 |
aaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaattggtgggaccccatcccggaccctg |
26573248 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgccct |
141 |
Q |
| |
|
| |||||| ||||| ||||||||| || |||||| |
|
|
| T |
26573249 |
cgtatgcgtgagctttagtgcaccaggctgccct |
26573282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 52926344 - 52926219
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcat |
110 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
52926344 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgta-------gtaaggctgcgtacaatacaccaaatggtgggacaccttcccggaccctgcgt |
52926252 |
T |
 |
| Q |
111 |
atgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||| |
|
|
| T |
52926251 |
atgcgggagctttagcgcaccgggttgcccttt |
52926219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 516431 - 516569
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa---tggtgggaccccttcccggacc |
104 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |||||| |||||| ||| ||||||||||||| |||| |
|
|
| T |
516431 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgcacaataaaccaaaaaatggcgggaccccttccccgacc |
516530 |
T |
 |
| Q |
105 |
ctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
516531 |
ctgcgtatgcgggagctttagtgcaccgggttgcccttt |
516569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 20 - 143
Target Start/End: Original strand, 14986989 - 14987116
Alignment:
| Q |
20 |
ggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcg |
115 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
14986989 |
ggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcg |
14987088 |
T |
 |
| Q |
116 |
ggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||| |||||||||||||| |||||| |
|
|
| T |
14987089 |
ggagctttagtgcaccgggtttcccttt |
14987116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 10 - 141
Target Start/End: Complemental strand, 8247824 - 8247688
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
8247824 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggactccttcccggaccc |
8247725 |
T |
 |
| Q |
106 |
tgcatatgcgggagctct-agtgcaccgggttgccct |
141 |
Q |
| |
|
||| |||||||||||| | ||||||| |||||||||| |
|
|
| T |
8247724 |
tgcgtatgcgggagctttaagtgcactgggttgccct |
8247688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 12 - 132
Target Start/End: Complemental strand, 6411954 - 6411833
Alignment:
| Q |
12 |
aggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcat |
110 |
Q |
| |
|
|||||| ||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||| ||| | |
|
|
| T |
6411954 |
aggtcatgggttcaagtcttgtaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatgatgggaccccttcccagaccttgcgt |
6411855 |
T |
 |
| Q |
111 |
atgcgggagctctagtgcaccg |
132 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
6411854 |
atgcgggagctttagtgcaccg |
6411833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 34420779 - 34420643
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| | |
|
|
| T |
34420779 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtaccatacaccaaaatggtgggaccccttcccggacctt |
34420680 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|| |||| ||||||| |||||||| || |||||||| |
|
|
| T |
34420679 |
gcgtatgtgggagctttagtgcacatggctgcccttt |
34420643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 34 - 143
Target Start/End: Complemental strand, 49013586 - 49013473
Alignment:
| Q |
34 |
aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
129 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| ||||||||| ||||||| |
|
|
| T |
49013586 |
aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtgca |
49013487 |
T |
 |
| Q |
130 |
ccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
49013486 |
ccgggttgcccttt |
49013473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 33 - 144
Target Start/End: Complemental strand, 45786328 - 45786213
Alignment:
| Q |
33 |
aaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgc |
128 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |||||| |||||| |
|
|
| T |
45786328 |
aaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgc |
45786229 |
T |
 |
| Q |
129 |
accgggttgcccttta |
144 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45786228 |
accgggttgcccttta |
45786213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 11 - 133
Target Start/End: Complemental strand, 45948972 - 45948848
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||| ||||| ||||| |||||||||||||| | |||||||||||| ||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
45948972 |
aaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaatagggtaaggctgcatacaatacaccaattggtgggaccccttctcggaccctgc |
45948873 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgg |
133 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
45948872 |
gtatgcgggagctttagtgcaccgg |
45948848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 10 - 127
Target Start/End: Original strand, 33926105 - 33926224
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacacca-aatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||||| |||||||||||||| ||| |||||||||||||||| ||||||||||||| ||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
33926105 |
aaaggtcatgggttcaagtcctggaaatagcctcttgtgtaaaaacagggtaaggctgtgtacaatacaccataatggtgggaccccttcctggaccctg |
33926204 |
T |
 |
| Q |
108 |
catatgcgggagctctagtg |
127 |
Q |
| |
|
|||||||| ||||| ||||| |
|
|
| T |
33926205 |
catatgcgagagctttagtg |
33926224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 50 - 141
Target Start/End: Complemental strand, 353444 - 353351
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
353444 |
aaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
353351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 5173855 - 5173719
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||| || |||||| ||| | |||||||||||| ||||||| |||||||||||||| | |
|
|
| T |
5173855 |
aaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaacaaagtaaggttgcatgcaatacaccaaaaatggtggggccccttcccggacctt |
5173756 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
5173755 |
gcgtatgcgggagctttagtgcaccgggttgcccttt |
5173719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 38 - 143
Target Start/End: Original strand, 26292382 - 26292487
Alignment:
| Q |
38 |
agcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
137 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||||||| ||||| ||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26292382 |
agcctcttgtgtaaaacagggtaagaccgcgtacgatacaccaaatgatgggatcccttcccgaaccctgcatatgcgggaactctagtgcaccgggttg |
26292481 |
T |
 |
| Q |
138 |
cccttt |
143 |
Q |
| |
|
||||| |
|
|
| T |
26292482 |
tccttt |
26292487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 53996701 - 53996565
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||| ||||||||| || ||||| |||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||| ||| || |
|
|
| T |
53996701 |
aaaggtcacgtgttcaagtcgtggaaacaacctcttgtgtaaaaaacagggtaaggctgcttacaatacaccaaaatggtgggaccccttccctgacact |
53996602 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|| |||| ||||||| |||||||||||| |||||||| |
|
|
| T |
53996601 |
gcgtatgtgggagctttagtgcaccgggctgcccttt |
53996565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 10 - 131
Target Start/End: Complemental strand, 54374481 - 54374357
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||| |||||||||| || ||||| |||||||||||||| | ||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
54374481 |
aaaggtcacaggttcaagtcttggaaacaacctcttgtgtaaaaaatagggtaaggctgcgtacaatccaccaaaatggtgggaccccttcccggaccct |
54374382 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
||||||||||||||| |||| |||| |
|
|
| T |
54374381 |
gcatatgcgggagctttagttcacc |
54374357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 10 - 121
Target Start/End: Complemental strand, 30928282 - 30928169
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| || ||||||| || ||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
30928282 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggtaaggttgtgtaaaatacaccaattggcgggaccccttcccggaccctg |
30928183 |
T |
 |
| Q |
108 |
catatgcgggagct |
121 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
30928182 |
catatgtgggagct |
30928169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 11 - 139
Target Start/End: Original strand, 7943013 - 7943143
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| |||||| ||||| ||||||||| |||||||||||||| |||||||||||| ||||| || |||| ||| |
|
|
| T |
7943013 |
aaggtcacggattcaagtcctggaaacagcatcttgtctaaaaaacagggtaagactgcgtacaatacatcaaatggtgggatccctttccagaccatgc |
7943112 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
|||||||||||| |||||||| |||||||| |
|
|
| T |
7943113 |
gtatgcgggagctttagtgcactgggttgcc |
7943143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 33 - 107
Target Start/End: Original strand, 47624087 - 47624162
Alignment:
| Q |
33 |
aaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624087 |
aaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
47624162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 4495798 - 4495676
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4495798 |
aaggtcacgggttcaagtcctgaaaatagcctattgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtggg------------accctgc |
4495711 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
4495710 |
gtatgcgggagctttagtgcaccgggttgcccttt |
4495676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 29 - 143
Target Start/End: Complemental strand, 25517287 - 25517170
Alignment:
| Q |
29 |
cctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctag |
125 |
Q |
| |
|
|||| ||||| |||||||||||||| || | || ||||||||||||||||| ||||||||||||||||||||||| ||||| ||||| |||||| ||| |
|
|
| T |
25517287 |
cctggaaacatcctcttgtgtaaaaaaacaagatatggctgcgtacaatacacaaaatggtgggaccccttcccggatcctgcgtatgctggagctttag |
25517188 |
T |
 |
| Q |
126 |
tgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
25517187 |
tgcaccgggttgcccttt |
25517170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 10 - 126
Target Start/End: Original strand, 9607225 - 9607345
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccc |
105 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| |||||| ||||||||||||||||| |||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
9607225 |
aaaggtcatcggttcaagtcctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtagaatacaccaataatgttgggaccccttcccagaccc |
9607324 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagt |
126 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
9607325 |
cgcatatgcgggagctttagt |
9607345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 25944491 - 25944627
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||| |||||||||||||| |||| |||||| |||||||| | ||| ||||||| ||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
25944491 |
aaaggtcatgggttcaagtcctggaaaccgcctctcgtgtaaaaaactgggcaaggctgagtacaatacaccaaaatggtgggaccccttccctgaccct |
25944590 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|| |||| ||||||| ||| ||||| || |||||||| |
|
|
| T |
25944591 |
gcgtatgtgggagctttagcgcaccaggctgcccttt |
25944627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 37 - 146
Target Start/End: Original strand, 9276313 - 9276422
Alignment:
| Q |
37 |
cagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
134 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||| || || ||| | ||| |
|
|
| T |
9276313 |
cagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggt-ggaccctttcccggaccctgcgtatgcgggaacttta-tgcgcaggg |
9276410 |
T |
 |
| Q |
135 |
ttgccctttaat |
146 |
Q |
| |
|
|||||||||||| |
|
|
| T |
9276411 |
ttgccctttaat |
9276422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 83 - 143
Target Start/End: Original strand, 30452892 - 30452952
Alignment:
| Q |
83 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30452892 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
30452952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 34 - 144
Target Start/End: Original strand, 31831245 - 31831344
Alignment:
| Q |
34 |
aaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
133 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31831245 |
aaacagcctcttgtgtaaaatagggtaaggctgcatacaatacaccaaatggt-----------ccggaccctgcatatgcgggtgctctagtgcaccgg |
31831333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 77 - 143
Target Start/End: Complemental strand, 24851367 - 24851301
Alignment:
| Q |
77 |
accaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24851367 |
accaaatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgcccttt |
24851301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 10 - 142
Target Start/End: Complemental strand, 45139613 - 45139479
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgtacaatacacc--aaatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||||||||| || || |
|
|
| T |
45139613 |
aaaggtcacgggttcaagttttggaaacaacctcttgtgtaaaacacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccaga-cc |
45139515 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
||| ||||||||| || | |||||||||| ||||||| |
|
|
| T |
45139514 |
tgcgtatgcgggaact-ttgtgcaccgggctgccctt |
45139479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 54032693 - 54032571
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||| ||||||||||| ||||||||| ||||||| |
|
|
| T |
54032693 |
aaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccgaatggtggg------------accctgc |
54032606 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
54032605 |
gtatgcgggagctttagtgcaccgggttgcccttt |
54032571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 45620964 - 45620881
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtggga |
90 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45620964 |
aaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaattggtggga |
45620881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 10 - 139
Target Start/End: Original strand, 19731024 - 19731155
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||| | ||||||||| ||| |||||||||||||||| || ||||||| ||||||||||||||| | ||||||||||| ||||| ||| ||| |
|
|
| T |
19731024 |
aaaggtcacggatgcaagtcctggaaatagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacacctattggtgggaccctttcccagactctg |
19731123 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
||||| |||||| |||||||||||| |||| |
|
|
| T |
19731124 |
tgtatgcaggagctttagtgcaccgggctgcc |
19731155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 20 - 144
Target Start/End: Original strand, 55401208 - 55401335
Alignment:
| Q |
20 |
ggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgg |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||| |||| ||||||| |||||||| |||||||||||||||||| |||||| | | ||||||| |
|
|
| T |
55401208 |
ggttcaagtcctgtaaacagcctcttgtgtaaaaaacaggttaagactgcgtataatacaccaaaatggtgggaccccttctcggaccttccgtatgcgg |
55401307 |
T |
 |
| Q |
117 |
gagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||||| | ||||||||| |||| |||| |
|
|
| T |
55401308 |
gagcttttttgcaccgggctgcctttta |
55401335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 139
Target Start/End: Complemental strand, 44403693 - 44403559
Alignment:
| Q |
8 |
taaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatac-accaaatggtgggaccccttcccggacc |
104 |
Q |
| |
|
||||||||||| |||| |||||||| || |||||||||||||||| || |||||||||||| | ||||| || ||||||||||||||||||||||||| |
|
|
| T |
44403693 |
taaaaggtcacaggttaaagtcctgggaatagcctcttgtgtaaaagacaaggtaaggctgcggagaataccacaaaatggtgggaccccttcccggacc |
44403594 |
T |
 |
| Q |
105 |
ctgcatatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
|| | ||||| | |||| |||||||||||| |||| |
|
|
| T |
44403593 |
ctacgtatgctgaagctttagtgcaccgggctgcc |
44403559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 10 - 121
Target Start/End: Complemental strand, 8411000 - 8410889
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||| |||||| |||||| |||| ||||| ||| |||||||||||||||||| |||||||||||| |||||||||| |||| | ||||||||| |
|
|
| T |
8411000 |
aaaggtcaccggttcaggtcctggaaactgcctcgtgtaaaaaacagggtaaggctgctcacaatacaccaactggtgggacctcttctcagaccctgca |
8410901 |
T |
 |
| Q |
110 |
tatgcgggagct |
121 |
Q |
| |
|
|| |||| |||| |
|
|
| T |
8410900 |
taggcggaagct |
8410889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 68 - 143
Target Start/End: Original strand, 24577917 - 24577992
Alignment:
| Q |
68 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||| ||||||||||| || ||||| |||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
24577917 |
gtacaatacactaaatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgcccttt |
24577992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 68 - 143
Target Start/End: Original strand, 24578007 - 24578082
Alignment:
| Q |
68 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||| |||||||||||| | ||||| |||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24578007 |
gtacaatacactaaatggtgggactctttcccagaccctacatatgcgggaactctagtgcaccgggttgcccttt |
24578082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 21 - 129
Target Start/End: Complemental strand, 43114994 - 43114882
Alignment:
| Q |
21 |
gttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaa-ggctgcgtacaatacaccaaatggtgggaccccttcccgga-ccctgcatatgcg |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||| |||| | |||||||||||||||||||||| ||||||| ||| |||||| |||||| |
|
|
| T |
43114994 |
gttcaagtcctggaaacagcctcttgtgtaaaaaaacagggtaagggctacctacaatacaccaaatggtggga-cccttcctggacccctgcgtatgcg |
43114896 |
T |
 |
| Q |
116 |
ggagctctagtgca |
129 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
43114895 |
ggagctttagtgca |
43114882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 10 - 70
Target Start/End: Complemental strand, 10870086 - 10870025
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgta |
70 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10870086 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgcgta |
10870025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 10 - 134
Target Start/End: Complemental strand, 52428613 - 52428479
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtc-ctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgg-------gaccccttccc |
99 |
Q |
| |
|
|||||||||||||| ||||| ||| || ||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||| | |
|
|
| T |
52428613 |
aaaggtcacgggtttaagtctctggaagcagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatagtggaaccccaaaccccttctc |
52428514 |
T |
 |
| Q |
100 |
ggaccctgcatatgcgggagctctagtgcaccggg |
134 |
Q |
| |
|
||||||| | |||| ||||||| |||||||||||| |
|
|
| T |
52428513 |
ggaccctacgtatgtgggagctttagtgcaccggg |
52428479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 10 - 139
Target Start/End: Original strand, 19751600 - 19751731
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||| | ||||||||| ||| |||||||||||||||| || ||||||| ||||||||||||||| | ||||||||||| ||||| ||| || |
|
|
| T |
19751600 |
aaaggtcacggatgcaagtcctggaaatagcctcttgtgtaaaaatcaaggtaaggttgcgtacaatacacctattggtgggaccctttcccagactttg |
19751699 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
||||| ||||| |||||||||||| |||| |
|
|
| T |
19751700 |
tgtatgcatgagctttagtgcaccgggctgcc |
19751731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 34 - 143
Target Start/End: Complemental strand, 50625064 - 50624953
Alignment:
| Q |
34 |
aaacagcctcttgtgta--aaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| ||||||||||||||| ||||||||| |||||| || |||||| || | ||||||| ||||||||| |
|
|
| T |
50625064 |
aaacagcctcttgtgtataaaaaagggtaaggtagcgtacaatacaccatttggtgggacgccttcctgggccctgcgtaagtgggagctttagtgcacc |
50624965 |
T |
 |
| Q |
132 |
gggttgcccttt |
143 |
Q |
| |
|
||| |||||||| |
|
|
| T |
50624964 |
gggctgcccttt |
50624953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 5 - 142
Target Start/End: Original strand, 33235548 - 33235687
Alignment:
| Q |
5 |
acataaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgg |
101 |
Q |
| |
|
|||| ||||||||| |||||| || || ||| |||||||||||||||| ||||||||| ||| ||||||||||| ||||||||||||||| || | | |
|
|
| T |
33235548 |
acatgaaaggtcacaagttcaaatcgtgtaaagagcctcttgtgtaaaaaaacagggtaagactgtgtacaatacactaaatggtgggacccc-tcgcag |
33235646 |
T |
 |
| Q |
102 |
accctgcatatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
||| | | ||||||| |||| ||||||||| |||||||||| |
|
|
| T |
33235647 |
accttacgtatgcggaagctttagtgcaccaggttgccctt |
33235687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 65 - 133
Target Start/End: Complemental strand, 829521 - 829452
Alignment:
| Q |
65 |
tgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
133 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||| ||||| |||||| ||||||||||| |
|
|
| T |
829521 |
tgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcaccgg |
829452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 88 - 148
Target Start/End: Complemental strand, 10484671 - 10484611
Alignment:
| Q |
88 |
ggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaatgt |
148 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
10484671 |
ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttatgt |
10484611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 27 - 142
Target Start/End: Complemental strand, 31904975 - 31904857
Alignment:
| Q |
27 |
gtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtggga-ccccttcccggaccctgcatatgcgggagctct |
123 |
Q |
| |
|
|||||| ||||||||| || ||||||| ||||||| | ||||||||||||||||||||||||||| ||||||||| || | | | | |||||||||| | |
|
|
| T |
31904975 |
gtcctggaaacagcctattatgtaaaaaacagggtatgactgcgtacaatacaccaaatggtgggacccccttcccagatcttacgtgtgcgggagcttt |
31904876 |
T |
 |
| Q |
124 |
agtgcaccgggttgccctt |
142 |
Q |
| |
|
|||||||| || ||||||| |
|
|
| T |
31904875 |
agtgcaccaggctgccctt |
31904857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 97 - 143
Target Start/End: Complemental strand, 6242331 - 6242285
Alignment:
| Q |
97 |
cccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6242331 |
cccggaccctgcatatgcaggagctctagtgcaccgggttgcccttt |
6242285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 12525429 - 12525564
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||||||||| ||||||||||||||| | | || |||||||||||| |||||| ||||||| |
|
|
| T |
12525429 |
aaaggtcacaggttcgagtcctggaaacagcctcttgtgtaaaaatcagggtaaggctgcgaagtacaccaaaaatggtgggacaccttcctagaccctg |
12525528 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| |||||||| | |||||| |||||| |||| |
|
|
| T |
12525529 |
tgtatacgggagcttcactgcaccaggttgctcttt |
12525564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 95 - 143
Target Start/End: Original strand, 47624208 - 47624256
Alignment:
| Q |
95 |
ttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
47624208 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
47624256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 78 - 140
Target Start/End: Original strand, 35417996 - 35418058
Alignment:
| Q |
78 |
ccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||| ||||| ||||||| |||| ||||| |
|
|
| T |
35417996 |
ccaaatggtgggaccccttcccggaccccgcaaatgcgagagctttagtgcatcgggctgccc |
35418058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 96
Target Start/End: Original strand, 29106571 - 29106659
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaatggtgggacccctt |
96 |
Q |
| |
|
|||| |||||||| |||||| |||||||| |||||||||| |||| ||| ||||| | ||||||||||||||||| |||||| ||||| |
|
|
| T |
29106571 |
aaagatcacgggtacaagtcttgaaaacaacctcttgtgtaaaaaataggataaggttacgtacaatacaccaaattgtgggatccctt |
29106659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 121
Target Start/End: Complemental strand, 46170038 - 46169989
Alignment:
| Q |
72 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
121 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
46170038 |
aataaaccaaatggtaggaccccttcccggaccctgcatatgtgggagct |
46169989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 35 - 144
Target Start/End: Original strand, 28904990 - 28905101
Alignment:
| Q |
35 |
aacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
||||| ||||||||||||| || |||||| ||| ||||| |||||||||| |||||||| |||||||||||||| || |||||| || ||||| | | |
|
|
| T |
28904990 |
aacagtctcttgtgtaaaataacaaggtaagactgtgtacattacaccaaata-tgggaccctttcccggaccctgcgtaagcgggaactttagtgtaac |
28905088 |
T |
 |
| Q |
132 |
gggttgcccttta |
144 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
28905089 |
gggctgcccttta |
28905101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 14 - 77
Target Start/End: Original strand, 39212016 - 39212081
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaa--aacagggtaaggctgcgtacaataca |
77 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||||||| |||| |||||| |||||||||||||| |
|
|
| T |
39212016 |
gtcacgggttcaagtcctggaaataacctcttgtgtaaataacaaggtaagactgcgtacaataca |
39212081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 102 - 143
Target Start/End: Original strand, 40390357 - 40390398
Alignment:
| Q |
102 |
accctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
40390357 |
accctgcgtatgcgggagctttagtgcaccgggttgcccttt |
40390398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 83 - 143
Target Start/End: Complemental strand, 14266431 - 14266372
Alignment:
| Q |
83 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||| |||| | ||||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
14266431 |
tggtgggaccc-ttcctgaaccctgcgtatgcgggagctttagtgcactgggttgcccttt |
14266372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 21875042 - 21875111
Alignment:
| Q |
17 |
acgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaaggctgcgtacaatacaccaaat |
83 |
Q |
| |
|
|||||||||| | ||| ||||| |||||||||| |||| |||||||||||||||||||||||| |||| |
|
|
| T |
21875042 |
acgggttcaaattctggaaacaacctcttgtgttaaaaaagagggtaaggctgcgtacaatacactaaat |
21875111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 80 - 143
Target Start/End: Original strand, 40968612 - 40968675
Alignment:
| Q |
80 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||| |||||||||| |||||| |||||||||||||| ||||||| || | |||||||| |
|
|
| T |
40968612 |
aaatggtgagaccccttcctagaccctacatatgcgggagctttagtgcatcgagctgcccttt |
40968675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 116
Target Start/End: Complemental strand, 21330339 - 21330273
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgg |
116 |
Q |
| |
|
|||| |||||||||| || ||||||||||||||| | ||||||| |||| |||| ||||||||||| |
|
|
| T |
21330339 |
aaaatagggtaaggccgcatacaatacaccaaattgcgggaccctttcctagaccatgcatatgcgg |
21330273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 12 - 53
Target Start/End: Original strand, 35417940 - 35417981
Alignment:
| Q |
12 |
aggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
53 |
Q |
| |
|
|||||||| |||||| ||||| |||||||||||||||||||| |
|
|
| T |
35417940 |
aggtcacgagttcaaatcctggaaacagcctcttgtgtaaaa |
35417981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 10 - 60
Target Start/End: Original strand, 53062060 - 53062112
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggta |
60 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||| ||||| ||||||||||| |
|
|
| T |
53062060 |
aaaggtcacgtgttcaagtcctggaaacagcctcctgtgtcaaaaacagggta |
53062112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 81)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 21172142 - 21172009
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21172142 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
21172043 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21172042 |
tatgcgggagctctagtgcaccgggttgcccttt |
21172009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 42391233 - 42391100
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42391233 |
aaaggtcacgggttcaagtcctggaaacagcttcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
42391134 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42391133 |
tatgcgggagctctagtgcaccgggttgcccttt |
42391100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 10 - 145
Target Start/End: Complemental strand, 10693206 - 10693071
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10693206 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaagagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
10693107 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgccctttaa |
145 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10693106 |
tatgcgggagctctagtgcactgggttgccctttaa |
10693071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 32758261 - 32758394
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32758261 |
aaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgca |
32758360 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32758361 |
tatgcgggagctctagtgcaccgggttgcccttt |
32758394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 10 - 144
Target Start/End: Complemental strand, 48735256 - 48735121
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcct-gaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||||| | ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48735256 |
aaaggtcacgggttcaagtccttggaaacaacctcttgtgtaaaacacggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
48735157 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
48735156 |
atatgcgggagctctagtgcaccgggttgcccttta |
48735121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 31591242 - 31591109
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||||| |||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
31591242 |
aaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaacagagtaaggctgcgtacaatacaataaatggtgggaccccttcccggaccttgca |
31591143 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31591142 |
tatgcgggagctctagtgcaccgggttgcccttt |
31591109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 10 - 145
Target Start/End: Complemental strand, 2541154 - 2541017
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2541154 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtactatacaccaaatggtgggaccccttcccggtccctg |
2541055 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgccctttaa |
145 |
Q |
| |
|
| |||||||||||| |||||||||||||| |||||||| |
|
|
| T |
2541054 |
cgtatgcgggagctttagtgcaccgggtttccctttaa |
2541017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 10 - 142
Target Start/End: Original strand, 11741795 - 11741927
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
11741795 |
aaaggtcatgggttcaagtcctgaaaacagcttctagtgtaaaatagggtaaggctgcgtacaatacaccaaatggtgggatcccttcccggattctgca |
11741894 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11741895 |
catgcgggagctctagtgcaccgggttgccctt |
11741927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 11 - 144
Target Start/End: Original strand, 47716460 - 47716597
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47716460 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacccc |
47716559 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
47716560 |
gcatatgcgggagctttggtgcaccgggttgcccttta |
47716597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 42805525 - 42805661
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42805525 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggacccc |
42805624 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42805625 |
gcatatgcgggagctttagtgcaccgggttgcccttt |
42805661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 27629634 - 27629769
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27629634 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtaaaatacaccaaatggtgggaccccttcccgggccctg |
27629733 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||| |
|
|
| T |
27629734 |
catatgcggtagcttcagtgcaccgggttgcccttt |
27629769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 7879639 - 7879773
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7879639 |
aaggtcacgggttcaagtcctggaaacaatctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
7879738 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
7879739 |
gtatgcgggagcttcagtgcaccgggttgcccttt |
7879773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 42798670 - 42798804
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42798670 |
aaggtcacgggttcaagtcttggaaacagtctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccctttcccggaccctgc |
42798769 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
42798770 |
atatgcgggagctatagtgcatcgggttgcccttt |
42798804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 8 - 142
Target Start/End: Original strand, 42476871 - 42477005
Alignment:
| Q |
8 |
taaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||| ||||||| ||| |||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | | ||| |
|
|
| T |
42476871 |
taaaaggtcacggattcaagttctggaaacagtctcttgtgtaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcctaggctctg |
42476970 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
42476971 |
catatgcgggagctctagtgcaccaggttgccctt |
42477005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 10 - 141
Target Start/End: Complemental strand, 18512587 - 18512455
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||||||||||||| ||||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18512587 |
aaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttcccggaccctgc |
18512488 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgccct |
141 |
Q |
| |
|
|||||||||||| | |||||| |||||||||| |
|
|
| T |
18512487 |
gtatgcgggagctttggtgcactgggttgccct |
18512455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 19427024 - 19426890
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
19427024 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaagactgcgtacaatacaccaaatggtggga-cccttctcggaccctg |
19426926 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| |
|
|
| T |
19426925 |
catatgcgagagcttcagtgcaccgggttgcccttt |
19426890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 10 - 142
Target Start/End: Complemental strand, 11617723 - 11617589
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||| ||||||||||||| ||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11617723 |
aaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcctggaccctg |
11617624 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
| ||||| ||| || |||||||||||||||||||| |
|
|
| T |
11617623 |
cgtatgcaggacctttagtgcaccgggttgccctt |
11617589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 10 - 139
Target Start/End: Complemental strand, 47077988 - 47077859
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||| || |||| | |||||||||||||| |||||||||||||||||||| ||||| || |
|
|
| T |
47077988 |
aaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaatagagtaaagttgcgtacaatacacaaaatggtgggaccccttcccaaaccctaca |
47077889 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
47077888 |
tatgcgggagctctagtgcaccggattgcc |
47077859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 10 - 144
Target Start/End: Complemental strand, 33872044 - 33871909
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||| ||||||||||||||| ||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33872044 |
aaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaacaggataaggctgcgtacaatacaccaaatggtgggaccccttcccagaccctgt |
33871945 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
|||||| ||||| ||||||||| ||||||| |||| |
|
|
| T |
33871944 |
gtatgcgagagctttagtgcaccaggttgcctttta |
33871909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 19265815 - 19265948
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||| || | |||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
19265815 |
aaaggtcacgggttcaagtcttggatacagccgcttgtgtaaaaagagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-cctac |
19265913 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
19265914 |
atatgtgggagctttagtgcaccgggctgcccttt |
19265948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 22 - 143
Target Start/End: Complemental strand, 34626330 - 34626208
Alignment:
| Q |
22 |
ttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagc |
120 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| |||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
34626330 |
ttcaagtcctggaaacagcctcctgtgtaaaaacagggtaaggctgcgttcaatacaccaaatggtgggatcccttcccggaccctgcgtatgcgggagc |
34626231 |
T |
 |
| Q |
121 |
tctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| |||| || ||||||||||||| |
|
|
| T |
34626230 |
tttagttcatcgggttgcccttt |
34626208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 20 - 133
Target Start/End: Complemental strand, 2663058 - 2662946
Alignment:
| Q |
20 |
ggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
119 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||| |
|
|
| T |
2663058 |
ggttcaagtcctggaaacagcctcttgtgtaaaatagggtaaggctgcgtacaatacaccaaatggtggga-cccttttcagaccctgcatatgcgggag |
2662960 |
T |
 |
| Q |
120 |
ctctagtgcaccgg |
133 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
2662959 |
ctctagcgcaccgg |
2662946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 40463878 - 40464011
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||| | |||||| ||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40463878 |
aaggtcacgggttcaagtcatagaaacagtctcttgtgtaaaaactgggtaaggctgcgtataatacaccaaatggtgggaccccttctcggaccctgcg |
40463977 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| |
|
|
| T |
40463978 |
tatgcgggagcttcagtgcaccgagttgcccttt |
40464011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 43557472 - 43557610
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||| ||||||| ||||||||||||||||||||||| |||||||||||||| |||||||| | |
|
|
| T |
43557472 |
aaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgggaccccctcccggactc |
43557571 |
T |
 |
| Q |
106 |
tgcatatgcgggagc-tctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| ||||||||||| | ||||||||||||||||||||| |
|
|
| T |
43557572 |
tgcgtatgcgggagcttttagtgcaccgggttgcccttt |
43557610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 11 - 141
Target Start/End: Complemental strand, 35334948 - 35334818
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcat |
110 |
Q |
| |
|
||||||||| |||||||||||| |||||| ||| ||| ||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
35334948 |
aaggtcacgagttcaagtcctggaaacagtctcgtgtaaaaaacagggtaagactgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgt |
35334849 |
T |
 |
| Q |
111 |
atgcgggagctctagtgcaccgggttgccct |
141 |
Q |
| |
|
|||| |||||| |||||||||||||| |||| |
|
|
| T |
35334848 |
atgcaggagctttagtgcaccgggtttccct |
35334818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 10 - 142
Target Start/End: Original strand, 18747486 - 18747621
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||||| ||||||| || ||||||||| |||||||||| ||||||||||||||||| |||||||||| |||||||||||||||| | ||||| |
|
|
| T |
18747486 |
aaaggtcacgggatcaagtcttggaaacagccttttgtgtaaaaaagcagggtaaggctgcgtataatacaccaattggtgggaccccttcctgaaccct |
18747585 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|| |||||||||||| |||||||||||| ||||||| |
|
|
| T |
18747586 |
gcgtatgcgggagctttagtgcaccgggctgccctt |
18747621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 10 - 142
Target Start/End: Original strand, 29907419 - 29907552
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||| || |||||||||||| ||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
29907419 |
aaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaatagtgtaaggctgcgttcaatacaccaaaatggtgggaccccatcccggaccct |
29907518 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
| |||||||||||| |||||||||||||||||||| |
|
|
| T |
29907519 |
g--tatgcgggagctttagtgcaccgggttgccctt |
29907552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 8 - 144
Target Start/End: Complemental strand, 23419811 - 23419673
Alignment:
| Q |
8 |
taaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||| ||||||||| ||| |||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23419811 |
taaaaggtcacaggttcaagttctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcctagacct |
23419712 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||| | |||||| ||| ||||||| |||| ||||||||| |
|
|
| T |
23419711 |
tgcgtgtgcgggggctttagtgcatcgggctgcccttta |
23419673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 11 - 114
Target Start/End: Original strand, 46354195 - 46354302
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46354195 |
aaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacccc |
46354294 |
T |
 |
| Q |
107 |
gcatatgc |
114 |
Q |
| |
|
|||||||| |
|
|
| T |
46354295 |
gcatatgc |
46354302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 10 - 121
Target Start/End: Original strand, 13805102 - 13805214
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacaggg-taaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||| ||||||||||||| |||||||| ||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
13805102 |
aaaggtaacgggttcaagtcctggaaatagcctctggtgtaaaacaggggtaaggctgtgtacaatacaccaaatggtgggaccacttcctggaccctgc |
13805201 |
T |
 |
| Q |
109 |
atatgcgggagct |
121 |
Q |
| |
|
|||||||||||| |
|
|
| T |
13805202 |
gtatgcgggagct |
13805214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 29 - 135
Target Start/End: Original strand, 38604546 - 38604654
Alignment:
| Q |
29 |
cctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctct-agt |
126 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| | ||| |
|
|
| T |
38604546 |
cctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgagacccctttccggaccctgcgtatgcgggagctttaagt |
38604645 |
T |
 |
| Q |
127 |
gcaccgggt |
135 |
Q |
| |
|
||||||||| |
|
|
| T |
38604646 |
gcaccgggt |
38604654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 38262330 - 38262196
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacag--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||| | ||||| | ||| |||||||||||||||| ||||||||||||||| || |||| |
|
|
| T |
38262330 |
aaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaaaatatggtaatgttgcatacaatacaccaaatgatgggaccccttcccgaacactgc |
38262231 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| |
|
|
| T |
38262230 |
gtatgcgggagctttagtgcaccggattgcccttt |
38262196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 10 - 121
Target Start/End: Original strand, 19266450 - 19266563
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||| |||||||||||||||||| |||| |||| |||||| |||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
19266450 |
aaaggtcgtgggttcaagtcctgaaaatagccacttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaattgtgggatcccttcccggaccctg |
19266549 |
T |
 |
| Q |
108 |
catatgcgggagct |
121 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
19266550 |
cgtatgcgggagct |
19266563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 32233269 - 32233135
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||| |||||||||||||| ||||| |||||||||||||| ||||||||||| ||||| | ||||||||||||||||| ||||||| ||||||| |
|
|
| T |
32233269 |
aaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaacagggtaaggcagcgtatattacaccaaatggtgggattccttcccaaaccctgc |
32233170 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||| ||||||| ||||||||||| |||||||| |
|
|
| T |
32233169 |
atatgagggagcttcagtgcaccgggctgcccttt |
32233135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 35 - 143
Target Start/End: Complemental strand, 35787378 - 35787269
Alignment:
| Q |
35 |
aacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
133 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||||||||||| |||||||||||||||||| ||| |||||||||||| | |||||||| |
|
|
| T |
35787378 |
aacagcctcttgtgtaaaaacatggtaaggttgcgtacaatacaccaaatggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgg |
35787279 |
T |
 |
| Q |
134 |
gttgcccttt |
143 |
Q |
| |
|
|||||||||| |
|
|
| T |
35787278 |
gttgcccttt |
35787269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 10 - 142
Target Start/End: Original strand, 16341278 - 16341413
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||| || ||||||||||| |
|
|
| T |
16341278 |
aaaggtcacgggttcaagttctagaaacagcctcttgtgtaaaaaacagggtaaggctacgtacaatacaccaaaatggtgggccctcttcccggaccta |
16341377 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|||||||||||||| | |||||||||| ||||||| |
|
|
| T |
16341378 |
tcatatgcgggagctttggtgcaccgggctgccctt |
16341413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 10 - 119
Target Start/End: Complemental strand, 48123619 - 48123508
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||| ||||||||| |||| |||||||||||||||||||||||||||| | ||||| || |
|
|
| T |
48123619 |
aaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaataacagggtaaaactgcatacaatacaccaaatggtgggacccctttctggaccatg |
48123520 |
T |
 |
| Q |
108 |
catatgcgggag |
119 |
Q |
| |
|
|||||||||||| |
|
|
| T |
48123519 |
catatgcgggag |
48123508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 60 - 143
Target Start/End: Complemental strand, 27889399 - 27889316
Alignment:
| Q |
60 |
aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | || |||||||||||||||| |
|
|
| T |
27889399 |
aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgcccttt |
27889316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 10 - 134
Target Start/End: Complemental strand, 28362280 - 28362155
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacag--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
28362280 |
aaaggtcacaggttcaagtcctagaaactgcctcttgtgtaaaaaacttggtaaggctgcgtacaatacaccaaatggtgggaccccttcccagaccttg |
28362181 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccggg |
134 |
Q |
| |
|
|||||| ||||||| | |||||||||| |
|
|
| T |
28362180 |
catatgtgggagct-ttgtgcaccggg |
28362155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 10 - 144
Target Start/End: Complemental strand, 22699105 - 22698966
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa--tggtgggacccctt-cccggacc |
104 |
Q |
| |
|
|||||| | |||||||||||||| ||| || ||||||||||||| ||||||||| ||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
22699105 |
aaaggttatgggttcaagtcctggaaatagtctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaaaatggtgggacccttttcccggacc |
22699006 |
T |
 |
| Q |
105 |
ctgcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||| |||||||||||| |||||||||||||| ||||||| |
|
|
| T |
22699005 |
ctgtgtatgcgggagctatagtgcaccgggttacccttta |
22698966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 14 - 134
Target Start/End: Original strand, 21566439 - 21566562
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcat |
110 |
Q |
| |
|
||||| |||||||||| || |||| ||||||||||||||| ||| | ||| ||||||||||||||||||| |||| ||||||||||||| ||||||||| |
|
|
| T |
21566439 |
gtcacaggttcaagtcttggaaaccgcctcttgtgtaaaaaacagaggaagactgcgtacaatacaccaaaatggtaggaccccttcccgaaccctgcat |
21566538 |
T |
 |
| Q |
111 |
atgcgggagctctagtgcaccggg |
134 |
Q |
| |
|
||||||||||| |||||||||||| |
|
|
| T |
21566539 |
atgcgggagctttagtgcaccggg |
21566562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 22 - 139
Target Start/End: Original strand, 1408469 - 1408588
Alignment:
| Q |
22 |
ttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
119 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| || |||||||||| |||||||||| |||||||||||||||||||||||||||||| ||||| | | |
|
|
| T |
1408469 |
ttcaagtcctggaaatagcctcttgtgtaaaaaacaaggtaaggctgtgtacaatacagcaaatggtgggaccccttcccggaccctgcgtatgcagaat |
1408568 |
T |
 |
| Q |
120 |
ctctagtgcaccgggttgcc |
139 |
Q |
| |
|
|| |||| |||||| ||||| |
|
|
| T |
1408569 |
ctttagttcaccggattgcc |
1408588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 26 - 144
Target Start/End: Original strand, 23231573 - 23231693
Alignment:
| Q |
26 |
agtcctgaaaacagcctcttgtgtaaaacag--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctct |
123 |
Q |
| |
|
||||||| ||| |||||||||||||||| | |||||||||||||| |||||||| |||| ||||||||||||||| ||||||| ||||||| |||| | |
|
|
| T |
23231573 |
agtcctggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagcttt |
23231672 |
T |
 |
| Q |
124 |
agtgcaccgggttgcccttta |
144 |
Q |
| |
|
||||||||| ||| ||||||| |
|
|
| T |
23231673 |
agtgcaccgagtttcccttta |
23231693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 10 - 118
Target Start/End: Original strand, 7644956 - 7645066
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||| |||| |||||||||||| || |||||| |
|
|
| T |
7644956 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagatagcgtacaatacaccaaaattgtgggacccctt-cctgaccct |
7645054 |
T |
 |
| Q |
107 |
gcatatgcggga |
118 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
7645055 |
gcgtatgcggga |
7645066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 10 - 119
Target Start/End: Complemental strand, 14099141 - 14099030
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||||| ||||| |||||||| ||| ||||| |||||||||| |||| |||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14099141 |
aaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaatggtgggaccccttcccgaacccta |
14099042 |
T |
 |
| Q |
108 |
catatgcgggag |
119 |
Q |
| |
|
| ||||| |||| |
|
|
| T |
14099041 |
cgtatgcaggag |
14099030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 10 - 119
Target Start/End: Complemental strand, 14409158 - 14409047
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||||| ||||| |||||||| ||| ||||| |||||||||| |||| |||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14409158 |
aaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaatggtgggaccccttcccgaacccta |
14409059 |
T |
 |
| Q |
108 |
catatgcgggag |
119 |
Q |
| |
|
| ||||| |||| |
|
|
| T |
14409058 |
cgtatgcaggag |
14409047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 11 - 121
Target Start/End: Complemental strand, 28078265 - 28078154
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||| |||||| ||| ||| |||| |||||||||| ||| | |||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
28078265 |
aaggtcacgggttcaagtcctagaaacagtctcgtgtaaaaaaacagggtaaggttgcatgcaatacaccaaatggtgggaccccttcccgaatcctgca |
28078166 |
T |
 |
| Q |
110 |
tatgcgggagct |
121 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
28078165 |
tatgcgagagct |
28078154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 14 - 99
Target Start/End: Complemental strand, 8149077 - 8148989
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttccc |
99 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8149077 |
gtcacgagttcaagtcctgaaaactacctcttgtgttaaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttccc |
8148989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 16 - 131
Target Start/End: Original strand, 39123896 - 39124018
Alignment:
| Q |
16 |
cacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||| |||| | ||||||||||||| ||||||| |||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39123896 |
cacgggttcaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgc |
39123995 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcacc |
131 |
Q |
| |
|
|||| ||||||| | ||||||| |
|
|
| T |
39123996 |
gtatgagggagctttggtgcacc |
39124018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 60 - 143
Target Start/End: Complemental strand, 45019010 - 45018923
Alignment:
| Q |
60 |
aaggctgcgtacaatacaccaaa----tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||| |||||| |||||| ||||||||||||||||||| |||||||||||| ||||||||| ||||||||||| |
|
|
| T |
45019010 |
aaggctgcgtacaatataccaaaaaactggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgcccttt |
45018923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 10 - 88
Target Start/End: Original strand, 6736890 - 6736969
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacaccaaatggtgg |
88 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||| | |||||| |||||| |||| |||||||||||||||||||| |
|
|
| T |
6736890 |
aaaggtcacgggttcaagtcctcaaaacaacctcttgtataaaaacaaggtaagactgcatacaatacaccaaatggtgg |
6736969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 10 - 82
Target Start/End: Original strand, 12473304 - 12473378
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaa |
82 |
Q |
| |
|
|||||||| |||||||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
12473304 |
aaaggtcatgggttcaagtcctgcaaacaacctcttgtgtcaaaaacagggtaaggatgcgtacaatacaccaaa |
12473378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 14 - 143
Target Start/End: Complemental strand, 14732953 - 14732821
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||| |||||||||||||| |||||||||| ||||||| |||||||||||||||| |||||||||||| ||||| || |||||||| |||||| |
|
|
| T |
14732953 |
gtcatgggttcaagtcctggaaacagcctcccatgtaaaaaacagggtaaggctgcgt-caatacaccaaaaatggtgaaactccttcccgaaccctgtt |
14732855 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
14732854 |
tatgcgggagctttagtgcaccggattgtccttt |
14732821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 10 - 121
Target Start/End: Original strand, 35203439 - 35203554
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc--aaatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||| |||||||| |||| |||||||||||| ||| ||||||||||| ||||||| | || | |
|
|
| T |
35203439 |
aaaggtcacgggttcaagtcctggaaacattctcttgtgtaaaaaacaggataagactgcgtacaatataccaaaaatggtgggatcccttcctgaactc |
35203538 |
T |
 |
| Q |
106 |
tgcatatgcgggagct |
121 |
Q |
| |
|
| | |||||||||||| |
|
|
| T |
35203539 |
tacgtatgcgggagct |
35203554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 51 - 143
Target Start/End: Complemental strand, 39093532 - 39093439
Alignment:
| Q |
51 |
aaacagggtaaggctgcgtacaatacacca-aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||| ||||||||||||| ||| |||||| ||||||||||| | ||||||||| | |||| |||||||||||| |||||||| |
|
|
| T |
39093532 |
aaacagggtaagactgtgtacaatacaccataatagtgggaacccttcccggaacttgcatatgcagaagctttagtgcaccgggctgcccttt |
39093439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 50 - 142
Target Start/End: Complemental strand, 3469270 - 3469176
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
||||||||||| || |||||||||||||||||| ||| |||||||||||| ||||||| |||||||||||| |||||| | ||||||||||| |
|
|
| T |
3469270 |
aaaacagggtacggttgcgtacaatacaccaaaaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtgcgctgggttgccctt |
3469176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 14 - 99
Target Start/End: Complemental strand, 15108527 - 15108441
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttccc |
99 |
Q |
| |
|
|||||| |||||||||||| |||||| |||||||| |||||| |||||||||| |||||||||| ||||| |||||| |||||||| |
|
|
| T |
15108527 |
gtcacgagttcaagtcctggaaacagtttcttgtgtaaaaacaaggtaaggctgtgtacaatacatcaaatagtgggatcccttccc |
15108441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 49 - 143
Target Start/End: Complemental strand, 23619071 - 23618977
Alignment:
| Q |
49 |
taaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||| ||||| || |||||||||| ||||||||||||||||||| | |||| ||| | ||| |||||| ||||||| ||||||||||||| |
|
|
| T |
23619071 |
taaaacagagtaagcttgtgtacaatacatcaaatggtgggaccccttcgcagaccttgcgtttgcaggagctttagtgcagcgggttgcccttt |
23618977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 51 - 118
Target Start/End: Original strand, 33500556 - 33500625
Alignment:
| Q |
51 |
aaacagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcggga |
118 |
Q |
| |
|
|||||||||||| |||||||| |||||| ||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33500556 |
aaacagggtaagactgcgtactatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcggga |
33500625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 50 - 143
Target Start/End: Complemental strand, 23066018 - 23065925
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||| ||| | |||||||||||||||| ||| ||||| ||||| ||| | |||||||||| ||||||| | ||||||||| ||||||||| |
|
|
| T |
23066018 |
aaaacaggataaagttgcgtacaatacaccatatgatgggatccctttccgaatcctgcatatgtgggagctttggtgcaccggattgcccttt |
23065925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 61 - 133
Target Start/End: Complemental strand, 36267900 - 36267827
Alignment:
| Q |
61 |
aggctgcgtacaatacaccaaatggtgggaccc-cttcccggaccctgcatatgcgggagctctagtgcaccgg |
133 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
36267900 |
aggctgcgtacaatacaccaaatggttggacccatttcccgaaccctgtgtatgcgggagctttagtgcaccgg |
36267827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 11 - 66
Target Start/End: Original strand, 18327035 - 18327091
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctg |
66 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| ||||||||||||||||| |
|
|
| T |
18327035 |
aaggtcacgggttcaagtcccggaaacagcctcttgtgtaaaaacagggtaaggctg |
18327091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 21 - 128
Target Start/End: Complemental strand, 42102009 - 42101899
Alignment:
| Q |
21 |
gttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcggg |
117 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| |||||||| ||||||||| ||| | ||| ||||||||||| |||||||||||||| ||| ||| |
|
|
| T |
42102009 |
gttcaagtcctggaaacagcctcttccgtaaaaaacagggtaacactgcgtacagtactctaaagtggtgggaccctttcccggaccctgcgtatccggc |
42101910 |
T |
 |
| Q |
118 |
agctctagtgc |
128 |
Q |
| |
|
|||| |||||| |
|
|
| T |
42101909 |
agctttagtgc |
42101899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 41 - 130
Target Start/End: Complemental strand, 21139851 - 21139761
Alignment:
| Q |
41 |
ctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
130 |
Q |
| |
|
||||||||||||| ||| |||||| || |||| ||||||||||||||||||||||||||| || ||| ||||||| |||| |||||||| |
|
|
| T |
21139851 |
ctcttgtgtaaaaacagagtaaggttggatacagtacaccaaatggtgggaccccttcccgaactctgtgtatgcggaagctttagtgcac |
21139761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 63
Target Start/End: Complemental strand, 42495970 - 42495916
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaagg |
63 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
42495970 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaacagggtaagg |
42495916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 17 - 121
Target Start/End: Complemental strand, 44123749 - 44123644
Alignment:
| Q |
17 |
acgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcg |
115 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||| ||||||| ||| | ||||||||| || |||||||| ||| ||||| |||| ||||| |
|
|
| T |
44123749 |
acgggttcaagtactggaaacagcctcttgtgtaaaaacaaggtaaggttgcatgaaatacaccatataatgggacccgttctcggacactgcgtatgca |
44123650 |
T |
 |
| Q |
116 |
ggagct |
121 |
Q |
| |
|
|||||| |
|
|
| T |
44123649 |
ggagct |
44123644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 82
Target Start/End: Complemental strand, 5180292 - 5180218
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaa |
82 |
Q |
| |
|
|||||||| |||||||| | ||| |||||||||||||||| ||||||||||||| ||| |||||| |||||||| |
|
|
| T |
5180292 |
aaaggtcaagggttcaacttctggaaacagcctcttgtgtcaaaaacagggtaagactgtgtacaacacaccaaa |
5180218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 143
Target Start/End: Complemental strand, 13792237 - 13792150
Alignment:
| Q |
57 |
ggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||| |||| ||||||||||| |||||| ||||||||||| || ||||||| ||||| |||||| | |||||||| | |||||||| |
|
|
| T |
13792237 |
ggtaagactgcatacaatacacccaaatggcgggaccccttctcgaaccctgcgtatgctggagcttttgtgcaccgagctgcccttt |
13792150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 96 - 143
Target Start/End: Original strand, 36602535 - 36602582
Alignment:
| Q |
96 |
tcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||| |||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
36602535 |
tcccagaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
36602582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 11 - 53
Target Start/End: Complemental strand, 7794640 - 7794598
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
53 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
7794640 |
aaggtcacgggttcaagtcctggaaacagcctcttatgtaaaa |
7794598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 50 - 127
Target Start/End: Complemental strand, 17048909 - 17048831
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
127 |
Q |
| |
|
|||||||||||||| | ||||||||||||| ||||||||| ||||||||||||| | ||| |||| |||||| ||||| |
|
|
| T |
17048909 |
aaaacagggtaaggttacgtacaatacaccaaaatggtggaaccccttcccggaacttgcttatgtaggagctttagtg |
17048831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 11 - 53
Target Start/End: Original strand, 21447591 - 21447633
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
53 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
21447591 |
aaggtcacggattcaagtcttgaaaacagcctcttgtgtaaaa |
21447633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 50 - 143
Target Start/End: Original strand, 25198768 - 25198861
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||| |||||| | ||||| ||| ||| ||||||| ||| |||||||| |||||| | |||| | ||||| |||||||||||||||| |||| |
|
|
| T |
25198768 |
aaaacaaggtaagaccgcgtataatgcactaaatggtaggatcccttcccagacccttcgtatgtgagagctttagtgcaccgggttgcacttt |
25198861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 92 - 140
Target Start/End: Complemental strand, 42495913 - 42495865
Alignment:
| Q |
92 |
cccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
140 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
42495913 |
cccttcccggaccctgcgtatgcgggagctttagtgcaccccgttgccc |
42495865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 80 - 143
Target Start/End: Original strand, 45811919 - 45811981
Alignment:
| Q |
80 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||| ||||| || |||||||| ||||| |||||| ||||||| ||||||||||||| |
|
|
| T |
45811919 |
aaatggtgggatccctttccagaccctgcttatgcaggagctttagtgca-cgggttgcccttt |
45811981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 7193085 - 7193127
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa |
52 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
7193085 |
aaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaa |
7193127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 77
Target Start/End: Original strand, 43852047 - 43852111
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaataca |
77 |
Q |
| |
|
||||||||||||||||||||||| | |||||| ||| |||||||||||||||| |||||||||| |
|
|
| T |
43852047 |
gtcacgggttcaagtcctgaaaa-aacctcttctgtaaaaaacagggtaaggctatgtacaataca |
43852111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 11 - 81
Target Start/End: Complemental strand, 1424044 - 1423972
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa |
81 |
Q |
| |
|
|||||||||| ||||| ||||| |||||| || |||||||||| |||||||| ||||| |||| |||||||| |
|
|
| T |
1424044 |
aaggtcacggattcaaatcctggaaacagtctgttgtgtaaaaaacagggtaatgctgcatacactacaccaa |
1423972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 85 - 146
Target Start/End: Original strand, 11888414 - 11888475
Alignment:
| Q |
85 |
gtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaat |
146 |
Q |
| |
|
|||||||||||| | |||||||| ||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
11888414 |
gtgggacccctttctggaccctgtgtatgcaggagcttcagtgcactgggttgccctttaat |
11888475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 21 - 141
Target Start/End: Original strand, 22065599 - 22065720
Alignment:
| Q |
21 |
gttcaagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
119 |
Q |
| |
|
|||||||| || ||||| |||||||||||||| ||||||| ||||| ||||||| | ||||| ||| |||||||||||| || || ||||| |||| |
|
|
| T |
22065599 |
gttcaagttttggaaacaacctcttgtgtaaaaatagggtaaagctgcatacaataaagcaaatagtgagaccccttcccgaactatgtgtatgcaggag |
22065698 |
T |
 |
| Q |
120 |
ctctagtgcaccgggttgccct |
141 |
Q |
| |
|
| ||||| |||||| |||||| |
|
|
| T |
22065699 |
ttttagtgtaccgggctgccct |
22065720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 25 - 141
Target Start/End: Original strand, 27697452 - 27697572
Alignment:
| Q |
25 |
aagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacc-aaatggt--gggacccctt-cccggaccctgcatatgcggga |
118 |
Q |
| |
|
|||||||| ||||| |||||||||||||| ||||| ||||||| || |||||||| ||||||| ||||||| || ||| |||||||| ||||||||| |
|
|
| T |
27697452 |
aagtcctggaaacaacctcttgtgtaaaaatcagggcaaggctgtgt--aatacaccaaaatggtgggggaccctttccccagaccctgcgtatgcggga |
27697549 |
T |
 |
| Q |
119 |
gctctagtgcaccgggttgccct |
141 |
Q |
| |
|
||| | ||||||||| |||||| |
|
|
| T |
27697550 |
gcttaaatgcaccgggatgccct |
27697572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 71)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 32703424 - 32703557
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32703424 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
32703523 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32703524 |
tatgcgggagctctagtgcaccgggttgcccttt |
32703557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 8170117 - 8169984
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8170117 |
aaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
8170018 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||| | |||||||||||||||||||| |
|
|
| T |
8170017 |
tatgcgggagtttcagtgcaccgggttgcccttt |
8169984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 35710313 - 35710446
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
35710313 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaatagggtaaggctgcgttcaatacaccaaatggtgggaccccttcccggaacatgca |
35710412 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35710413 |
tatgcgggagctctagtgcaccgggttgcccttt |
35710446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 41014320 - 41014453
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
41014320 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcctggaccccgca |
41014419 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
41014420 |
tatgcgggagctttagtgcaccgggttgcccttt |
41014453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 25 - 140
Target Start/End: Original strand, 7368413 - 7368528
Alignment:
| Q |
25 |
aagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctcta |
124 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7368413 |
aagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaattggtgggaccccttcccggaccctgcatatgtgggagctcta |
7368512 |
T |
 |
| Q |
125 |
gtgcaccgggttgccc |
140 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7368513 |
gtgcaccgggttgccc |
7368528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 24448891 - 24449025
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24448891 |
aaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
24448990 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||| |
|
|
| T |
24448991 |
gtatgcaggagctttagtgcaccgggttgcccttt |
24449025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 38879581 - 38879718
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38879581 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccc |
38879680 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
38879681 |
tgcgtatgcgggagctttagtgcaccgggttgcccttt |
38879718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 4619240 - 4619104
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4619240 |
aaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacccc |
4619141 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
4619140 |
gcatatgcgagagctttagtgcaccgggttgcccttt |
4619104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 43334202 - 43334339
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaaggctgcgtacaatacacc--aaatggtgggaccccttcccggacc |
104 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43334202 |
aaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggacc |
43334301 |
T |
 |
| Q |
105 |
ctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
43334302 |
ctgc-gatgcgggagctttagtgcaccgggttgcccttt |
43334339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 19 - 144
Target Start/End: Complemental strand, 13801895 - 13801766
Alignment:
| Q |
19 |
gggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgc |
114 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
13801895 |
gggttcaagtcctggaagcagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgc |
13801796 |
T |
 |
| Q |
115 |
gggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
| ||||| |||||||||||||||||||||| |
|
|
| T |
13801795 |
gagagctttagtgcaccgggttgcccttta |
13801766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 49 - 144
Target Start/End: Complemental strand, 34154908 - 34154813
Alignment:
| Q |
49 |
taaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34154908 |
taaatcagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcccttta |
34154813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 13 - 134
Target Start/End: Original strand, 43574609 - 43574732
Alignment:
| Q |
13 |
ggtcacgggttcaagtcctgaaaacagcctcttgtgta--aaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcat |
110 |
Q |
| |
|
||||||| |||||||||||| ||||| |||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
43574609 |
ggtcacgtgttcaagtcctggaaacaatctcttgtgtagaaaacagggtaaggctgcgtacaatataccaaatggtgggaccccttcccggaccctgcgt |
43574708 |
T |
 |
| Q |
111 |
atgcgggagctctagtgcaccggg |
134 |
Q |
| |
|
||||||||||| ||| |||||||| |
|
|
| T |
43574709 |
atgcgggagctttagagcaccggg |
43574732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 35 - 144
Target Start/End: Complemental strand, 16880757 - 16880646
Alignment:
| Q |
35 |
aacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccg |
132 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| ||||||||||| ||| |||||||||||| |||||||||| |
|
|
| T |
16880757 |
aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccg |
16880658 |
T |
 |
| Q |
133 |
ggttgcccttta |
144 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
16880657 |
ggtttcccttta |
16880646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 20 - 143
Target Start/End: Complemental strand, 19143067 - 19142943
Alignment:
| Q |
20 |
ggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggga |
118 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
19143067 |
ggttcaagtcctggaaacaacctcttgtgtaaaaacagggtaaggctgcgtacagtacaccaaatggtgggaccccttcccggaccatgcgtatgcggga |
19142968 |
T |
 |
| Q |
119 |
gctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| | |||||||| || |||||||| |
|
|
| T |
19142967 |
gatttagtgcactggcctgcccttt |
19142943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 10 - 144
Target Start/End: Original strand, 1565431 - 1565567
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||| ||||||||||||||| ||||| ||||||| |||||| || |||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
1565431 |
aaaggtcgcgggttcaagtcctggaaacaacctcttgagtaaaaaaacatattaaggctgcgtacaatgcaccaaatggcgggaccccttcccggaccct |
1565530 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
1565531 |
gcatatgtgggagct-tagtgcaccgggttgcccttta |
1565567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 10 - 139
Target Start/End: Original strand, 27328752 - 27328885
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||| ||||||||||||| |||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
27328752 |
aaaggtcacaggttcaagtcctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccgaaccc |
27328851 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
||| |||||||||||| || |||| ||| ||||| |
|
|
| T |
27328852 |
tgcgtatgcgggagctttaatgcatcggattgcc |
27328885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 32 - 144
Target Start/End: Complemental strand, 7097872 - 7097759
Alignment:
| Q |
32 |
gaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
130 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
7097872 |
gaaaacagcctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaatggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcac |
7097773 |
T |
 |
| Q |
131 |
cgggttgcccttta |
144 |
Q |
| |
|
| | ||||||||| |
|
|
| T |
7097772 |
catgctgcccttta |
7097759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 1405188 - 1405322
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| | ||||| | | ||||| ||||||||||||||||||||||||||||| |||| | ||||||| |
|
|
| T |
1405188 |
aaggtcacgggttcaagtcctggaaacaacctcttatataaaaaatagagtaagtttgcgtacaatacaccaaatggtgggaccctttcctgaaccctgc |
1405287 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||| |
|
|
| T |
1405288 |
atatgcgggagctctagtacaccggattgcccttt |
1405322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 29 - 142
Target Start/End: Original strand, 20135623 - 20135740
Alignment:
| Q |
29 |
cctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctcta |
124 |
Q |
| |
|
|||| |||||||||||||||||||| || ||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |||||| | |
|
|
| T |
20135623 |
cctggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttca |
20135722 |
T |
 |
| Q |
125 |
gtgcaccgggttgccctt |
142 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
20135723 |
gtgcaccgggttgccctt |
20135740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 22861801 - 22861669
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||| |||||||||| || ||| ||||||||||||||| | |||| |||| |||||||| ||||||||||||||||||| || |||||||| |
|
|
| T |
22861801 |
aaaggtcacggattcaagtcctagaagcagtctcttgtgtaaaacaag-taagactgctcacaatacatcaaatggtgggaccccttctcgaaccctgca |
22861703 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
22861702 |
tatgcgggagctctagtgcaccgaattgcccttt |
22861669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 68 - 143
Target Start/End: Original strand, 16957374 - 16957449
Alignment:
| Q |
68 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
16957374 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
16957449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 34 - 120
Target Start/End: Original strand, 2838803 - 2838890
Alignment:
| Q |
34 |
aaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagc |
120 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
2838803 |
aaacagcatcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggatcccttctcggaccctgcgtatgcgggagc |
2838890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 11 - 121
Target Start/End: Original strand, 22600455 - 22600567
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||| |||||||||||||||| ||||| | |||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
22600455 |
aaggttacgggttcaagtcctggaaacaatattttgtgtaaaacacagggtaaggctgtgtacaatacaccaaatggtgggatcccttcccggatcctgc |
22600554 |
T |
 |
| Q |
109 |
atatgcgggagct |
121 |
Q |
| |
|
|||||||||||| |
|
|
| T |
22600555 |
gtatgcgggagct |
22600567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 28516569 - 28516433
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||||||||||||| || ||||| |||||||||||||| |||| || |||||||||||||||| |||| ||||||||||| ||||| |||||| |
|
|
| T |
28516569 |
aaaggtcacgggttcaagtcttggaaacatcctcttgtgtaaaaaacaggctagggctgcgtacaatacatcaaaatggtgggacccattcccagaccct |
28516470 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|| |||| |||||| ||||| ||| ||||||||||| |
|
|
| T |
28516469 |
gcgcatgcaggagctttagtggaccaggttgcccttt |
28516433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 34 - 143
Target Start/End: Original strand, 29334419 - 29334531
Alignment:
| Q |
34 |
aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacca-aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
130 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||| ||||||||||||| |||||||||||||| |||| |||| || || ||||| |
|
|
| T |
29334419 |
aaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccagaatggtgggacccattcccggaccctgcgtatgtgggatctttaatgcac |
29334518 |
T |
 |
| Q |
131 |
cgggttgcccttt |
143 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
29334519 |
cgggctgcccttt |
29334531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 209064 - 208936
Alignment:
| Q |
8 |
taaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||| |||||||||||| |||| |||||||||||||| |||||||||||||| | |||||||||||| |||||||||||||||| |||||| |
|
|
| T |
209064 |
taaaaggtcacaagttcaagtcctggcaacaacctcttgtgtaaaaacagggtaaggctgcattcaatacaccaaaatggtgggaccccttcctggaccc |
208965 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccggg |
134 |
Q |
| |
|
|| ||||| ||||| |||||||||||| |
|
|
| T |
208964 |
tgggtatgcaagagctttagtgcaccggg |
208936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 133
Target Start/End: Original strand, 1850640 - 1850764
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||||||||||| | ||| | |||||||||||||| ||| ||||| ||||||||||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
1850640 |
aaaggtcacgggttcaagtcccggaaataacctcttgtgtaaaaacagaataagggtgcgtacaatacatcaaatggtgggaccacttcctggaccctgc |
1850739 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgg |
133 |
Q |
| |
|
|||||| |||| ||||||||||| |
|
|
| T |
1850740 |
ggatgcggaagctttagtgcaccgg |
1850764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 10 - 142
Target Start/End: Complemental strand, 12006465 - 12006329
Alignment:
| Q |
10 |
aaaggtcacggg-ttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggacc |
104 |
Q |
| |
|
|||||||||||| |||||||| || ||||| |||||| ||||||| | |||||||||| | ||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
12006465 |
aaaggtcacggggttcaagtc-tggaaacaacctcttatgtaaaaaatagggtaaggctccatacaatacaccaataatggtgggaccccttcccagacc |
12006367 |
T |
 |
| Q |
105 |
ctgcatatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|||| |||||||||||| |||||||||| ||||||||| |
|
|
| T |
12006366 |
ctgcctatgcgggagctttagtgcaccgtgttgccctt |
12006329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 84 - 143
Target Start/End: Complemental strand, 16028683 - 16028624
Alignment:
| Q |
84 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16028683 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
16028624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 10 - 73
Target Start/End: Complemental strand, 37024689 - 37024626
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaa |
73 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37024689 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaa |
37024626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 50 - 143
Target Start/End: Original strand, 3771381 - 3771474
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||| | |||||||||||| ||||||||||||||||||||| ||| |||| ||||||| |||||||||||| |||||||| |
|
|
| T |
3771381 |
aaaacagggtaaggctgtgaacaatacaccaattggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgggctgcccttt |
3771474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 22 - 144
Target Start/End: Original strand, 30006337 - 30006461
Alignment:
| Q |
22 |
ttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
119 |
Q |
| |
|
||||||||| ||||||| |||||| | |||| |||||||||||||| ||||| ||||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
30006337 |
ttcaagtccggaaaacaacctcttatataaacaacagggtaaggctgtgtacattacactaaatggtgggaccccttcccggggcctatgtatgcgggag |
30006436 |
T |
 |
| Q |
120 |
ctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
|| ||||||||||||||||| |||| |
|
|
| T |
30006437 |
ctttagtgcaccgggttgcctttta |
30006461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 84 - 145
Target Start/End: Complemental strand, 30877623 - 30877562
Alignment:
| Q |
84 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaa |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30877623 |
ggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgccctttaa |
30877562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 25 - 144
Target Start/End: Complemental strand, 5873441 - 5873321
Alignment:
| Q |
25 |
aagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctct |
123 |
Q |
| |
|
||||| || |||||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||| ||| ||||||| |||| |||||||||||| | |
|
|
| T |
5873441 |
aagtcgtggaaacagcctcttgtgtaaaaatagggtaaggctaagtacactacaccaattggtgggactcctccccggacactgcgtatgcgggagcttt |
5873342 |
T |
 |
| Q |
124 |
agtgcaccgggttgcccttta |
144 |
Q |
| |
|
|||||| |||| ||||||||| |
|
|
| T |
5873341 |
agtgcatcgggatgcccttta |
5873321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 28 - 144
Target Start/End: Complemental strand, 12575779 - 12575659
Alignment:
| Q |
28 |
tcctgaaaacagcctcttgtgtaaa---acagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctct |
123 |
Q |
| |
|
||||| ||||||||||||| ||||| ||||| ||| | |||||||||||||||||| |||||||||||||||| ||||||||| ||||| |||||| | |
|
|
| T |
12575779 |
tcctggaaacagcctcttgcgtaaataaacaggctaaagttgcgtacaatacaccaaaatggtgggaccccttcctggaccctgcgtatgcaggagcttt |
12575680 |
T |
 |
| Q |
124 |
agtgcaccgggttgcccttta |
144 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
12575679 |
ggtgcaccgggctgcccttta |
12575659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 42924969 - 42924830
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc--aaatggtgggaccccttcccgg--ac |
103 |
Q |
| |
|
|||||||||| |||||||||||||||||| | |||||||| |||||||||||||| ||||||||||||||| ||||| ||| | |||||||| | || |
|
|
| T |
42924969 |
aaaggtcacgagttcaagtcctgaaaacaacatcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaaaatgatggaatcccttcccagacac |
42924870 |
T |
 |
| Q |
104 |
cctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||| ||||||| |||| ||||||||||| ||| ||||| |
|
|
| T |
42924869 |
cctgcgtatgcggaagctttagtgcaccggattgtccttt |
42924830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 134
Target Start/End: Original strand, 39301123 - 39301249
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtg--taaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||||||||||||| || |||| ||||||||| ||||||||||||||| |||||| ||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
39301123 |
aaaggtcacgggttcaagtcttgggaacaacctcttgtgtataaaacagggtaaggatgcgtataatgcaccaaaaaggtgggaccccttcccggaccct |
39301222 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccggg |
134 |
Q |
| |
|
| |||| ||||| | |||||||||||| |
|
|
| T |
39301223 |
ccgtatgtgggag-tttagtgcaccggg |
39301249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 7 - 108
Target Start/End: Original strand, 41425945 - 41426048
Alignment:
| Q |
7 |
ataaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacc |
104 |
Q |
| |
|
|||||| ||||||||||||||| ||| ||||| | | |||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
41425945 |
ataaaatgtcacgggttcaagttctggaaacaacttattgtgtaaaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttcccagact |
41426044 |
T |
 |
| Q |
105 |
ctgc |
108 |
Q |
| |
|
|||| |
|
|
| T |
41426045 |
ctgc |
41426048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 21 - 121
Target Start/End: Complemental strand, 24323829 - 24323727
Alignment:
| Q |
21 |
gttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggga |
118 |
Q |
| |
|
|||||||| ||| ||||| |||||||||||||| ||||||||| |||||| ||||| |||||| ||||||||||||||| ||||||| |||||||||| |
|
|
| T |
24323829 |
gttcaagttctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatagtgggaccccttcccagaccctgtatatgcggga |
24323730 |
T |
 |
| Q |
119 |
gct |
121 |
Q |
| |
|
||| |
|
|
| T |
24323729 |
gct |
24323727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 21 - 121
Target Start/End: Complemental strand, 24360453 - 24360351
Alignment:
| Q |
21 |
gttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggga |
118 |
Q |
| |
|
|||||||| ||| ||||| |||||||||||||| ||||||||| |||||| ||||| |||||| ||||||||||||||| ||||||| |||||||||| |
|
|
| T |
24360453 |
gttcaagttctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatagtgggaccccttcccagaccctgtatatgcggga |
24360354 |
T |
 |
| Q |
119 |
gct |
121 |
Q |
| |
|
||| |
|
|
| T |
24360353 |
gct |
24360351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 22907999 - 22907913
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggacccct |
95 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||| ||| |||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
22907999 |
aaaggtcaagggttcaagtccaagaaacagcctcttgtgtaaaaacagagtaaggttgcatacaatacaccaaatggtgggacccct |
22907913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 24 - 143
Target Start/End: Complemental strand, 24903817 - 24903696
Alignment:
| Q |
24 |
caagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
121 |
Q |
| |
|
||||||||||||||||||| |||||||||| | ||||||| || ||||||| |||||| ||||| ||||||||||||||| ||||||| |||||| || |
|
|
| T |
24903817 |
caagtcctgaaaacagccttttgtgtaaaaaatagggtaagattgtgtacaatccaccaattggtgagaccccttcccggacactgcatacgcgggaact |
24903718 |
T |
 |
| Q |
122 |
ctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| |||||||||| || ||||| |
|
|
| T |
24903717 |
ttggtgcaccgggctgtccttt |
24903696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 81 - 143
Target Start/End: Original strand, 25622533 - 25622595
Alignment:
| Q |
81 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||||| |
|
|
| T |
25622533 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt |
25622595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 10 - 144
Target Start/End: Original strand, 22187285 - 22187423
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc--aaatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||| |||| |||||||| |||||||||||||||| |||||| | |||| |||||||||||||||| ||| || ||||||||||| |||| |
|
|
| T |
22187285 |
aaaggtcaccggtttaagtcctggaaacagcctcttgtgtaaaaaacatgataagactgcgtacaatacaccaaaaacaatgagaccccttcccaaaccc |
22187384 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
| ||||||| |||||| ||||||| | |||||||||||| |
|
|
| T |
22187385 |
tacatatgcaggagctttagtgcatcaggttgcccttta |
22187423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 58 - 143
Target Start/End: Complemental strand, 11657785 - 11657699
Alignment:
| Q |
58 |
gtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||| |||||||| | |||||| || |||| ||||||| |||||||| |
|
|
| T |
11657785 |
gtaaggctgcatacaatacaccaaaatggtgggaccccttcccgaaccctgcacacgcgggaactttagttcaccgggctgcccttt |
11657699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 134
Target Start/End: Complemental strand, 34074697 - 34074573
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||| || |||||| ||||| ||||||||||||||| || ||||||||| |||||| |
|
|
| T |
34074697 |
aaaggtcacaagttcaagtcctagaaacagcctcttgtgtaaaaaacacagtaaggttgcgttcaatacaccaaatggcagggccccttcccaaaccctg |
34074598 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccggg |
134 |
Q |
| |
|
| |||| ||||| ||||||||||||| |
|
|
| T |
34074597 |
cgtatgggggag--ctagtgcaccggg |
34074573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 50 - 133
Target Start/End: Complemental strand, 9794471 - 9794388
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
133 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||| |||||| | ||||| |||||||| | |||| ||||||||||| |
|
|
| T |
9794471 |
aaaacagggtaagactgcatacaatacaccaaatagtgggatcccttcacagacccagcatatgcagaagctttagtgcaccgg |
9794388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 73 - 143
Target Start/End: Complemental strand, 10943914 - 10943845
Alignment:
| Q |
73 |
atacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||| |||||||| |
|
|
| T |
10943914 |
atacaccaaataacgggaccccttcccggaccctgca-atgcgggagctttagtgcaccgggctgcccttt |
10943845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 64 - 134
Target Start/End: Original strand, 13774921 - 13774991
Alignment:
| Q |
64 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
134 |
Q |
| |
|
||||| |||||||||||||||| ||| ||||| ||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
13774921 |
ctgcgcacaatacaccaaatggcaggatccctttccggaccctgcgtatgcgggagctttagtgcaccggg |
13774991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 59 - 131
Target Start/End: Complemental strand, 12477205 - 12477132
Alignment:
| Q |
59 |
taaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||| ||||| ||||| ||||||||| |
|
|
| T |
12477205 |
taaggctgcgtacaatacaccaaaatggtgggaccccttcccggattctgcgtatgcaagagctttagtgcacc |
12477132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 70 - 121
Target Start/End: Complemental strand, 10306548 - 10306496
Alignment:
| Q |
70 |
acaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagct |
121 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10306548 |
acaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagct |
10306496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 80 - 140
Target Start/End: Complemental strand, 21784395 - 21784335
Alignment:
| Q |
80 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
140 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||| | |||||||||| ||||||| |
|
|
| T |
21784395 |
aaatggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccgagttgccc |
21784335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 83 - 139
Target Start/End: Original strand, 39801591 - 39801647
Alignment:
| Q |
83 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
||||||||||||||||| |||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
39801591 |
tggtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgcc |
39801647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 99 - 142
Target Start/End: Original strand, 19438757 - 19438800
Alignment:
| Q |
99 |
cggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19438757 |
cggaccctgcatatgcgggagctctagtgcaccaggttgccctt |
19438800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 10 - 66
Target Start/End: Original strand, 22025543 - 22025601
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctg |
66 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
22025543 |
aaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctg |
22025601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 92 - 143
Target Start/End: Original strand, 32354211 - 32354262
Alignment:
| Q |
92 |
cccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
32354211 |
cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttt |
32354262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 13 - 106
Target Start/End: Original strand, 18698614 - 18698707
Alignment:
| Q |
13 |
ggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaata-caccaaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||| |||| |||||| ||||||| | |||||| ||||| |||||||||||||| |
|
|
| T |
18698614 |
ggtcacgggttcaagtactgaaaacagcctcttgt-aaaaacaaggtacggctgcatacaatatgtcaaaatggcgggactccttcccggaccct |
18698707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 96 - 141
Target Start/End: Original strand, 11462913 - 11462958
Alignment:
| Q |
96 |
tcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
141 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11462913 |
tcccgaactctgcatatgcgggagctctagtgcaccgggttgccct |
11462958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 11 - 68
Target Start/End: Original strand, 23974781 - 23974840
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcg |
68 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| |||| |||||||||||||| |
|
|
| T |
23974781 |
aaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaagagggtaaggctgcg |
23974840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 80 - 131
Target Start/End: Complemental strand, 4654478 - 4654427
Alignment:
| Q |
80 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
4654478 |
aaatggtgggatcccttctcgaaccctgcatatgcgggagctttagtgcacc |
4654427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 78 - 121
Target Start/End: Complemental strand, 21542532 - 21542489
Alignment:
| Q |
78 |
ccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
121 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
21542532 |
ccaaatggtgggaccccttcccggactctgcgtatgcgggagct |
21542489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 145
Target Start/End: Complemental strand, 31694233 - 31694106
Alignment:
| Q |
20 |
ggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggg |
117 |
Q |
| |
|
|||||||||| |||||| || | || |||||||| | || ||| ||||| ||||||||||| | || |||||| ||||||| |||| ||| |||||||| |
|
|
| T |
31694233 |
ggttcaagtcttgaaaaaagtcactcgtgtaaaaaataggctaaagctgcatacaatacacctattgatgggactccttcccagaccttgcgtatgcggg |
31694134 |
T |
 |
| Q |
118 |
agctctagtgcaccgggttgccctttaa |
145 |
Q |
| |
|
|| | ||||||||| | |||||||||| |
|
|
| T |
31694133 |
agatttagtgcaccagactgccctttaa |
31694106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 68 - 139
Target Start/End: Complemental strand, 39079827 - 39079755
Alignment:
| Q |
68 |
gtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| || ||| |||||| | |||||||| ||| |||| |
|
|
| T |
39079827 |
gtacaatacaccaaaatggtgggaccccttcccggaccatgtgtatacgggagttttagtgcacagggctgcc |
39079755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 80 - 143
Target Start/End: Original strand, 19093885 - 19093948
Alignment:
| Q |
80 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||| ||||||| |||||||||||| |||| |||||| |||||||||||| |||||||| |
|
|
| T |
19093885 |
aaatggtatgacccctacccggaccctgcgtatgttggagctttagtgcaccgggctgcccttt |
19093948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 50 - 143
Target Start/End: Complemental strand, 24313667 - 24313572
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccgg-accctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||| | ||||| ||||| |||||||||||| ||||||||||||||||||| || || ||||| | |||| |||||||||||| |||||||| |
|
|
| T |
24313667 |
aaaacaagataaggttgcgttcaatacaccaaaatggtgggaccccttcccggcgccatgtgtatgctgtagctttagtgcaccgggctgcccttt |
24313572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 50 - 143
Target Start/End: Complemental strand, 24356004 - 24355909
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccgg-accctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||| | ||||| ||||| |||||||||||| ||||||||||||||||||| || || ||||| | |||| |||||||||||| |||||||| |
|
|
| T |
24356004 |
aaaacaagataaggttgcgttcaatacaccaaaatggtgggaccccttcccggcgccatgtgtatgctgtagctttagtgcaccgggctgcccttt |
24355909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 130
Target Start/End: Complemental strand, 3176839 - 3176770
Alignment:
| Q |
58 |
gtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
130 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||| ||||||| ||| ||||| |||||| |||||||| |
|
|
| T |
3176839 |
gtaaggttgcgtacaatacaccaactggtgggaccc---cccggactctgtgtatgccggagctttagtgcac |
3176770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 39
Target Start/End: Complemental strand, 9794495 - 9794465
Alignment:
| Q |
9 |
aaaaggtcacgggttcaagtcctgaaaacag |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9794495 |
aaaaggtcacgggttcaagtcctgaaaacag |
9794465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 57 - 126
Target Start/End: Original strand, 15141929 - 15141998
Alignment:
| Q |
57 |
ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagt |
126 |
Q |
| |
|
|||| ||||| || ||||||| ||||||||||||||||||| | ||||||| ||| |||||||| |||| |
|
|
| T |
15141929 |
ggtagggctgtgtgcaatacatcaaatggtgggaccccttcttgaaccctgcttatacgggagctttagt |
15141998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 101 - 142
Target Start/End: Complemental strand, 29184103 - 29184062
Alignment:
| Q |
101 |
gaccctgcatatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|||| ||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
29184103 |
gaccatgcgtatgcgggagctttagtgcaccgggttgccctt |
29184062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 68 - 143
Target Start/End: Complemental strand, 37226037 - 37225961
Alignment:
| Q |
68 |
gtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| ||| ||| ||||| ||| | |||||||| || ||||||||| |
|
|
| T |
37226037 |
gtacaatacaacaaaatggtgggaccccttcccgaaccatgcgtatgccagaggtttagtgcactggattgcccttt |
37225961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 126; Significance: 5e-65; HSPs: 63)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 12670383 - 12670250
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12670383 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
12670284 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
12670283 |
tatgcgggagctctagtgcaccgggttacccttt |
12670250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 30454230 - 30454097
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30454230 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacaaggtaaggctgcgtacgatacaccaaatggtgggaccccttcccggaccctgca |
30454131 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30454130 |
tatgcgggagctctagtgcaccgggttgcccttt |
30454097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 11 - 148
Target Start/End: Original strand, 13160703 - 13160841
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13160703 |
aaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcg |
13160802 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgccctttaatgt |
148 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
13160803 |
tatgcgggagcttcagtgcgccgggttgccctttaatgt |
13160841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 28817760 - 28817626
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28817760 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacccaatggtgggaccccttcccggaccctgc |
28817661 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||| |
|
|
| T |
28817660 |
gtatgcgggagctttagtgcatcgggttgcccttt |
28817626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 36720797 - 36720931
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36720797 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
36720896 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
36720897 |
gtatgcggaagctttagtgcacccggttgcccttt |
36720931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 11 - 142
Target Start/End: Original strand, 45071266 - 45071398
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45071266 |
aaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcg |
45071365 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |
|
|
| T |
45071366 |
tatgcgggagcttcagtgcaccgggttgccctt |
45071398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 11 - 148
Target Start/End: Original strand, 44530150 - 44530289
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||||||||| || ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44530150 |
aaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgc |
44530249 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgccctttaatgt |
148 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||| |||| |
|
|
| T |
44530250 |
gtatgcgggagctttagtgcaccgggttgaccttttatgt |
44530289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 35261680 - 35261814
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||||||| |||| |||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35261680 |
aaggtcacgggttcaagccctggaaacagtctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcctggaccctgc |
35261779 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
35261780 |
gtatgcgggagctttagtgcaccgggttgcccttt |
35261814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 39461131 - 39460994
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
39461131 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgagaccccttcccggaccc |
39461032 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
39461031 |
tgcgtatgcgggagctttagtgcaccgggttgcccttt |
39460994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 6760823 - 6760959
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
6760823 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggcttcgtacaatacaccaataatggtgggaccccttctcggacccc |
6760922 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6760923 |
gcatatgcgggagctttagtgcaccgggttgcccttt |
6760959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 10 - 144
Target Start/End: Original strand, 17823576 - 17823712
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||| |||| ||||||| ||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
17823576 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaccaggataagactgcgtaaaatacaccaaatggtggaaccccttcccgaaccctg |
17823675 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
17823676 |
catatgcaggagctttagtgcaccgggttgcccttta |
17823712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 29521819 - 29521685
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| ||| |||| |||||||| |
|
|
| T |
29521819 |
aaggtcacgggttcaagtcctggaaacagcctcttgtttaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaacccatcccagaccctgc |
29521720 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||| |
|
|
| T |
29521719 |
gtatgcgggagctttagtgcaccgggttgctcttt |
29521685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 7136663 - 7136527
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||| |||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7136663 |
aaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaccagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacccc |
7136564 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
7136563 |
gcatatgcgggagctttagtgcaccgggttacccttt |
7136527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 12 - 143
Target Start/End: Original strand, 12625891 - 12626025
Alignment:
| Q |
12 |
aggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||| |||||||||| ||||| |||||||||||||| ||||||||| |||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12625891 |
aggtcacgggctcaagtcctggaaacaacctcttgtgtaaaaaaacagggtaagactgcatacaatacaccaaatggtgggaccccctcccggaccctgc |
12625990 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
12625991 |
gtatgcgggagctttagtgcaccgggttgcccttt |
12626025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 26954133 - 26954270
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccc |
105 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
26954133 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagacct |
26954232 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
26954233 |
cgcatatgcgggagctttagtgcactgggttgcccttt |
26954270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 8897898 - 8897764
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||| |||||||| ||||| || ||||||||||| | |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8897898 |
aaggtcacgggttgaagtcctggaaacaaccgcttgtgtaaaaaatagggtaaggctacgtacaatacaccaaatggtgggaccccttcccggaccctgc |
8897799 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||| || |||||| ||||||||||| |
|
|
| T |
8897798 |
atatgcgggagctttactgcacccggttgcccttt |
8897764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 10 - 120
Target Start/End: Complemental strand, 20869631 - 20869523
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
20869631 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgtgtacaatacaccaa--ggtgagaccccttcccggaccctgca |
20869534 |
T |
 |
| Q |
110 |
tatgcgggagc |
120 |
Q |
| |
|
||||||||||| |
|
|
| T |
20869533 |
tatgcgggagc |
20869523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 2626519 - 2626657
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-----cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacc |
104 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
2626519 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaaaacagggtaagactgcgtacaatacaccaaatgatgggaccccttcccagacc |
2626618 |
T |
 |
| Q |
105 |
ctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||| |||||||| | ||||||||| |
|
|
| T |
2626619 |
ctgcatatgcgggagcttcagtgcaccagattgcccttt |
2626657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 10 - 139
Target Start/End: Complemental strand, 18164894 - 18164764
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |||||||||||||||||| | || |||| |||||||||||||| |
|
|
| T |
18164894 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaaggatgtgaccatttcccggaccctgc |
18164795 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |
|
|
| T |
18164794 |
gtatgcgggagctttagtgcaccgggttgcc |
18164764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 34 - 143
Target Start/End: Original strand, 19729366 - 19729475
Alignment:
| Q |
34 |
aaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
133 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
19729366 |
aaacagtctcttatgtaaaacagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatacgggagctctagtgcactgg |
19729465 |
T |
 |
| Q |
134 |
gttgcccttt |
143 |
Q |
| |
|
||||||||| |
|
|
| T |
19729466 |
attgcccttt |
19729475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 16 - 143
Target Start/End: Complemental strand, 5135418 - 5135290
Alignment:
| Q |
16 |
cacgggttcaagtcctgaaaacagcctcttgtgtaaaacag--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatg |
113 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| || |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5135418 |
cacgggttcaagtcctggaaacagcctcttgtgtaaaaaagagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatg |
5135319 |
T |
 |
| Q |
114 |
cgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| |||||| | |||||||||| |||||||| |
|
|
| T |
5135318 |
caggagct-ttgtgcaccgggctgcccttt |
5135290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 31457173 - 31457307
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||| ||| |||||||||||||||||| |||||||| |||||||||||| ||||||| |
|
|
| T |
31457173 |
aaaggtcacgggttcaagtcctgtaaacaacctcttgtgtaaaaataggaaaaggctgcgtacaatacatcaaatggtaggaccccttcccaaaccctgc |
31457272 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
31457273 |
gtatgcgggagctctagtgcaccggattgcccttt |
31457307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 10 - 137
Target Start/End: Complemental strand, 20284208 - 20284075
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca----gggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggac |
103 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||| | |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20284208 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggac |
20284109 |
T |
 |
| Q |
104 |
cctgcatatgcgggagctctagtgcaccgggttg |
137 |
Q |
| |
|
||||| |||||||||| | ||||||||||||||| |
|
|
| T |
20284108 |
cctgcgtatgcgggagttttagtgcaccgggttg |
20284075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 10 - 137
Target Start/End: Complemental strand, 21070837 - 21070703
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca-----gggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccgga |
102 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||| | |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21070837 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccgga |
21070738 |
T |
 |
| Q |
103 |
ccctgcatatgcgggagctctagtgcaccgggttg |
137 |
Q |
| |
|
|||||| |||||||||| | ||||||||||||||| |
|
|
| T |
21070737 |
ccctgcgtatgcgggagttttagtgcaccgggttg |
21070703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 28 - 143
Target Start/End: Original strand, 20869941 - 20870060
Alignment:
| Q |
28 |
tcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctct |
123 |
Q |
| |
|
||||| |||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |||||| ||||||||||||||| | |
|
|
| T |
20869941 |
tcctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagcttt |
20870040 |
T |
 |
| Q |
124 |
agtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
20870041 |
agtgcaccgggttgcccttt |
20870060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 27 - 141
Target Start/End: Original strand, 29877111 - 29877227
Alignment:
| Q |
27 |
gtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctcta |
124 |
Q |
| |
|
|||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
29877111 |
gtcctggaaacagccttttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcgtta |
29877210 |
T |
 |
| Q |
125 |
gtgcaccgggttgccct |
141 |
Q |
| |
|
||||||| || |||||| |
|
|
| T |
29877211 |
gtgcaccaggctgccct |
29877227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 8 - 121
Target Start/End: Complemental strand, 24365197 - 24365081
Alignment:
| Q |
8 |
taaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacc |
104 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24365197 |
taaaatgtcacgggttcaagccctagaaacagcctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaaatggtgggaccccttcccggacc |
24365098 |
T |
 |
| Q |
105 |
ctgcatatgcgggagct |
121 |
Q |
| |
|
|||| |||| ||||||| |
|
|
| T |
24365097 |
ctgcgtatgtgggagct |
24365081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 25250523 - 25250659
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||| |||||||||||| ||||||||| |||||||||| | ||||| |||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
25250523 |
aaggtcacatgttcaagtcctggaaacagcctattgtgtaaaaaatagggtatggctgcgtacaatacaccaataatggtgggaccccttcccgaacccc |
25250622 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
25250623 |
gcatatgcgggagatttagtgcaccgggttgcccttt |
25250659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 14 - 134
Target Start/End: Complemental strand, 8484069 - 8483947
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcata |
111 |
Q |
| |
|
|||| |||||||||||||| ||||| |||||||||||||| ||||| |||||||||||||||||||||| |||||||||||| |||| |||||||| || |
|
|
| T |
8484069 |
gtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggcaaggctgcgtacaatacaccaattggtgggaccccatcccagaccctgcgta |
8483970 |
T |
 |
| Q |
112 |
tgcgggagctctagtgcaccggg |
134 |
Q |
| |
|
|||||||||| ||| |||||||| |
|
|
| T |
8483969 |
tgcgggagctttagggcaccggg |
8483947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 10 - 133
Target Start/End: Original strand, 389643 - 389770
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt----aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||| ||||| ||||| || ||||| |
|
|
| T |
389643 |
aaaggtcacgggttcaagtcctggaaacaccctcttgtgtcaaaaaaacagggtaaggttgcgtacaatacaccaaatgatgggatccctttcctgaccc |
389742 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgg |
133 |
Q |
| |
|
||| |||||| ||||| ||||||||||| |
|
|
| T |
389743 |
tgcgtatgcgagagctttagtgcaccgg |
389770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 19 - 138
Target Start/End: Original strand, 5689640 - 5689761
Alignment:
| Q |
19 |
gggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgg |
116 |
Q |
| |
|
||||||||||| || ||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||| ||| |||| || |
|
|
| T |
5689640 |
gggttcaagtcttgtaaatagcctcttgtgtaaaaagcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaaccatgcgtatgtgg |
5689739 |
T |
 |
| Q |
117 |
gagctctagtgcaccgggttgc |
138 |
Q |
| |
|
||||| ||||||||||| |||| |
|
|
| T |
5689740 |
gagctttagtgcaccggtttgc |
5689761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 69 - 143
Target Start/End: Original strand, 26102578 - 26102652
Alignment:
| Q |
69 |
tacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26102578 |
tacaatacaccaaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgcccttt |
26102652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 34 - 143
Target Start/End: Original strand, 10857852 - 10857964
Alignment:
| Q |
34 |
aaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
130 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| |||||||||||| |||||||||| ||||| ||||| ||| |||||||||||| |||||||| |
|
|
| T |
10857852 |
aaaccgcctcttgtgtaaaaaaacagggtaaggctgcgcacaatacaccaattggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcac |
10857951 |
T |
 |
| Q |
131 |
cgggttgcccttt |
143 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10857952 |
cgggttgcccttt |
10857964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 36 - 144
Target Start/End: Original strand, 16225045 - 16225157
Alignment:
| Q |
36 |
acagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
|||||||||| ||||||| ||||||||| |||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
16225045 |
acagcctcttatgtaaaaaacagggtaagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcacc |
16225144 |
T |
 |
| Q |
132 |
gggttgcccttta |
144 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
16225145 |
gggttgtccttta |
16225157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 10 - 130
Target Start/End: Complemental strand, 44781641 - 44781517
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgtacaatacacc--aaatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
|||| |||||||||||||||||| ||||| ||||||||||||| |||||||||||||| |||||||||||| ||||| ||||||||| |||| ||||| |
|
|
| T |
44781641 |
aaagttcacgggttcaagtcctggaaacaacctcttgtgtaaaagacagggtaaggctgtgtacaatacaccaaaaatgttgggaccccgtcccagaccc |
44781542 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcac |
130 |
Q |
| |
|
||| |||||||||||| |||||||| |
|
|
| T |
44781541 |
tgcgtatgcgggagctttagtgcac |
44781517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 28407417 - 28407538
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
28407417 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggc------------accaaatggtgggaccccttcccggaccctacg |
28407504 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| |
|
|
| T |
28407505 |
tatgcgggagctttactgcaccgggttgcccttt |
28407538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 131
Target Start/End: Original strand, 22598157 - 22598279
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||| ||||| ||||| |||||||||||||| |||||||||||| |||||||||||||| ||||| ||||| |||||||||| || |
|
|
| T |
22598157 |
aaaggtcacgggttcaaatcctggaaacaacctcttgtgtaaaaaacagggtaaggctatgtacaatacaccaattggtgagaccctttcccggaccttg |
22598256 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcacc |
131 |
Q |
| |
|
| ||||||||| || ||||||||| |
|
|
| T |
22598257 |
cgtatgcggga-ctttagtgcacc |
22598279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 144
Target Start/End: Complemental strand, 23000351 - 23000227
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||| || ||||||| | | ||||||||||||||||||||||||||||||||| |
|
|
| T |
23000351 |
aaaggtcacgggt--aagtcctggaaacagcctcttgtgtaaaaacacggtaaggttccatacaatacaccaaatggtgggaccccttcccgg------- |
23000261 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
23000260 |
--atgcgggagctttagtgcaccgggttgcccttta |
23000227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 36 - 144
Target Start/End: Complemental strand, 23286432 - 23286336
Alignment:
| Q |
36 |
acagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
135 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23286432 |
acagcctcttgtgtaaaacagggtaaagctgcgtacaatacaccaaatggtggg------------accctgcatatgcgggagctctagtgcaccgggc |
23286345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 10 - 106
Target Start/End: Original strand, 35105923 - 35106022
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgtacaatacacca-aatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||| | || ||||||||||||||||||||||| |||||||||||| ||||| ||||||| |
|
|
| T |
35105923 |
aaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaagagagtgtaaggctgcgtacaatacaccagaatggtgggacctcttcctggaccct |
35106022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 10 - 142
Target Start/End: Complemental strand, 42083834 - 42083699
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||| | ||| ||||||||||||| || ||| ||||||||||||||||||||| ||||| |
|
|
| T |
42083834 |
aaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatggggcaaggctgcgtacagtataccaaaatggtgggaccccttcccgaaccct |
42083735 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
| || | ||||||| ||||||| ||| ||||||| |
|
|
| T |
42083734 |
gtgtacgtgggagctttagtgcattgggctgccctt |
42083699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 21 - 140
Target Start/End: Complemental strand, 17251001 - 17250879
Alignment:
| Q |
21 |
gttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgg |
116 |
Q |
| |
|
|||||||||||| || ||||||||||||||||| |||| |||||| |||||||||||||||| |||||||||||| |||||| ||||||| |||| | |
|
|
| T |
17251001 |
gttcaagtcctggaagcagcctcttgtgtaaaaaacaggttaaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaag |
17250902 |
T |
 |
| Q |
117 |
gagctctagtgcaccgggttgccc |
140 |
Q |
| |
|
||||| ||||||| |||||||||| |
|
|
| T |
17250901 |
gagctttagtgca-cgggttgccc |
17250879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 11 - 140
Target Start/End: Complemental strand, 44742653 - 44742521
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||| | |||||||| ||| ||||| ||| ||||||||| |||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
44742653 |
aaggtcatgagttcaagttctggaaacaatctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcttggacccta |
44742554 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgccc |
140 |
Q |
| |
|
| |||||||||| |||||||||||| ||||| |
|
|
| T |
44742553 |
cggatgcgggagcattagtgcaccggggtgccc |
44742521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 10 - 121
Target Start/End: Complemental strand, 14018104 - 14017990
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||| ||||||||||| || |||||| ||||||||| |||||||||| || ||||||||||||||| ||| |||||||||| ||||| ||||||| |
|
|
| T |
14018104 |
aaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaaaacagggtgagactgcgtacaatacactaaattggtgggaccacttcctggaccct |
14018005 |
T |
 |
| Q |
107 |
gcatatgcgggagct |
121 |
Q |
| |
|
||| |||||| |||| |
|
|
| T |
14018004 |
gcagatgcggtagct |
14017990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 55 - 136
Target Start/End: Original strand, 26457776 - 26457855
Alignment:
| Q |
55 |
agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggtt |
136 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| || |||| ||| |||| ||||||| |||||||||||||| |
|
|
| T |
26457776 |
agggtaaggctgcgtacaatacaccaattggtgggacccct--cctgaccttgcgtatgagggagctttagtgcaccgggtt |
26457855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 65 - 143
Target Start/End: Original strand, 16013511 - 16013591
Alignment:
| Q |
65 |
tgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||| ||| ||||| ||||||||||| |||||||| |||||||||||| ||||||||||||||| ||||| |
|
|
| T |
16013511 |
tgcgtacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtccttt |
16013591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 10 - 121
Target Start/End: Original strand, 24245451 - 24245562
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaa---tggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||||||||||||||||| |||| | ||||| ||||| ||||||||| || |||||||| ||||||| | |||||||||||||| ||||||| |
|
|
| T |
24245451 |
aaaggtcacgggttcaagtcctggaaac-gtctcttatgtaa--cagggtaagactacgtacaatgcaccaaaaaattgtgggaccccttcctggaccct |
24245547 |
T |
 |
| Q |
107 |
gcatatgcgggagct |
121 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
24245548 |
gcgtatgcgggagct |
24245562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 121
Target Start/End: Complemental strand, 11001085 - 11000971
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||| ||||||||| | ||||||||| ||| ||||||||| || | |||||||| |||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
11001085 |
aaaggtcgcgggttcaaattctgaaaacaacctactgtgtaaaaaaacaagataaggctgtgtacaatacaccaaatggtgggacccctacccgaaccct |
11000986 |
T |
 |
| Q |
107 |
gcatatgcgggagct |
121 |
Q |
| |
|
| ||||| |||||| |
|
|
| T |
11000985 |
gtttatgcaggagct |
11000971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 33 - 99
Target Start/End: Original strand, 43942347 - 43942417
Alignment:
| Q |
33 |
aaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc--aaatggtgggaccccttccc |
99 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43942347 |
aaaacagcctcttatgtcaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttccc |
43942417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 83 - 142
Target Start/End: Original strand, 27507985 - 27508044
Alignment:
| Q |
83 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||| ||||||||||||||| |||| |
|
|
| T |
27507985 |
tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgtcctt |
27508044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 80 - 143
Target Start/End: Complemental strand, 35107374 - 35107311
Alignment:
| Q |
80 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| |||| ||||||||||||||||||||| |
|
|
| T |
35107374 |
aaatggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgcccttt |
35107311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 14 - 114
Target Start/End: Original strand, 11748303 - 11748407
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtaca--atacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||||||||||| || |||||||||||| ||||||| ||||||||| | ||||||| ||||| ||||||| ||||||||||||| | |||||| |
|
|
| T |
11748303 |
gtcacgggttcaagtcttggaaacagcctcttttgtaaaaagcagggtaagacagcgtacaatatacaaaaaatggtaggaccccttcccgaatcctgca |
11748402 |
T |
 |
| Q |
110 |
tatgc |
114 |
Q |
| |
|
||||| |
|
|
| T |
11748403 |
tatgc |
11748407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 27468141 - 27468092
Alignment:
| Q |
94 |
cttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
27468141 |
cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
27468092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 18 - 144
Target Start/End: Original strand, 33866957 - 33867088
Alignment:
| Q |
18 |
cgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatat |
112 |
Q |
| |
|
|||||||||||||| |||||| | | |||||||||| ||||||||| |||| ||||||||| ||| ||||| || ||||||| ||||||| ||| |
|
|
| T |
33866957 |
cgggttcaagtcctaaaaacaactttttgtgtaaaaaagcagggtaagactgcatacaatacataaaaaatggtgacacttcttcccgaaccctgcgtat |
33867056 |
T |
 |
| Q |
113 |
gcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
|| | |||| |||||||||||||||||||||| |
|
|
| T |
33867057 |
gcagaagctttagtgcaccgggttgcccttta |
33867088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 82 - 142
Target Start/End: Complemental strand, 36486627 - 36486567
Alignment:
| Q |
82 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
||||||||||| ||||||||||| ||| ||||| |||||| |||||| ||||||||||||| |
|
|
| T |
36486627 |
atggtgggacctcttcccggaccttgcgtatgcaggagctttagtgccccgggttgccctt |
36486567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 54 - 129
Target Start/End: Complemental strand, 30231420 - 30231344
Alignment:
| Q |
54 |
cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
129 |
Q |
| |
|
|||| ||||||||||||||||| |||||| ||||||||||| | |||| ||||| |||| | ||||||| ||||||| |
|
|
| T |
30231420 |
caggataaggctgcgtacaatataccaaaatggtgggacccttacccgaaccctccatacgtgggagctttagtgca |
30231344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 88 - 139
Target Start/End: Original strand, 18595918 - 18595969
Alignment:
| Q |
88 |
ggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||| ||||||||| |
|
|
| T |
18595918 |
ggaccccttcccggaccctgtgtatgcgggagttttagtgcatcgggttgcc |
18595969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 30962908 - 30962865
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
53 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
30962908 |
aaaggtcacgacttcaagtcctggaaacagcctcttgtgtaaaa |
30962865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 143
Target Start/End: Complemental strand, 40605031 - 40604906
Alignment:
| Q |
19 |
gggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgg |
116 |
Q |
| |
|
||||||||||| || ||||| || |||||||||| | || ||||| |||||||||||||| ||||| ||| | ||||||| ||||| | ||||||| |
|
|
| T |
40605031 |
gggttcaagtcatggaaacaatcttttgtgtaaaaaattggataaggttgcgtacaatacactaaatgatgg-atcccttccgaaaccctacgtatgcgg |
40604933 |
T |
 |
| Q |
117 |
gagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||| |||||||||| ||||||||| |
|
|
| T |
40604932 |
gagctttagtgcaccgaattgcccttt |
40604906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 99 - 144
Target Start/End: Complemental strand, 30962815 - 30962770
Alignment:
| Q |
99 |
cggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
|||||||||| |||||||||| | ||||| |||||||||||||||| |
|
|
| T |
30962815 |
cggaccctgcgtatgcgggagatttagtgaaccgggttgcccttta |
30962770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 50 - 83
Target Start/End: Original strand, 36918166 - 36918199
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaat |
83 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
36918166 |
aaaacagggtaaggctgtgtacaatacaccaaat |
36918199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 82 - 114
Target Start/End: Original strand, 12483584 - 12483616
Alignment:
| Q |
82 |
atggtgggaccccttcccggaccctgcatatgc |
114 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
12483584 |
atggtgggaccccttcccggaccctacatatgc |
12483616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 87 - 143
Target Start/End: Original strand, 40444845 - 40444901
Alignment:
| Q |
87 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||| ||||||||||| |||| |||||| |||||||||| | |||||||| |
|
|
| T |
40444845 |
gggaccccttgccggaccctgcgtatgttggagctttagtgcaccgagctgcccttt |
40444901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 126; Significance: 5e-65; HSPs: 52)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 1346964 - 1347097
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1346964 |
aaaggtcacgggttcaagtcctggaaacagccacttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
1347063 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1347064 |
tatgcgggagctctagtgcaccgggttgcccttt |
1347097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 1354890 - 1354757
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1354890 |
aaaggtcactggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
1354791 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1354790 |
tatgcgggagctctagtgcaccgggttgcccttt |
1354757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 28 - 143
Target Start/End: Original strand, 26097178 - 26097293
Alignment:
| Q |
28 |
tcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
127 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26097178 |
tcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatgaagggaccccttcccggaccctgcatatgcgggagctctagtg |
26097277 |
T |
 |
| Q |
128 |
caccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
26097278 |
caccgggttgcccttt |
26097293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 29355992 - 29355855
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa--aacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29355992 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccc |
29355893 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
29355892 |
tgcgtatgcgggagctttagtgcaccgggttgcccttt |
29355855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 28 - 143
Target Start/End: Original strand, 25557743 - 25557858
Alignment:
| Q |
28 |
tcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
127 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25557743 |
tcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatgaaggaaccccttcccggaccctgcatatgcgggagctctagtg |
25557842 |
T |
 |
| Q |
128 |
caccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
25557843 |
caccgggttgcccttt |
25557858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 12222052 - 12221914
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccc |
105 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12222052 |
aaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccc |
12221953 |
T |
 |
| Q |
106 |
tgcatatgcgggagc-tctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| ||||||||||| | ||||||||||||||||||||| |
|
|
| T |
12221952 |
tgcgtatgcgggagcttttagtgcaccgggttgcccttt |
12221914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 9 - 143
Target Start/End: Original strand, 28007627 - 28007760
Alignment:
| Q |
9 |
aaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| | ||| | |
|
|
| T |
28007627 |
aaaaggtcacgggttcaagtcctggaaagagcctcttgtgtaaaacagggtcaggctgcgtacaatacaccaaatgctgggaccccttccc-taacctcc |
28007725 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||| |
|
|
| T |
28007726 |
atatgcggaagctctagtgcaccggattacccttt |
28007760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 2166547 - 2166410
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||| |||| ||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2166547 |
aaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataatggtgggaccccttcccggaccc |
2166448 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| |||| |||||||| ||||||||||||||||||||| |
|
|
| T |
2166447 |
tatatattcgggagctttagtgcaccgggttgcccttt |
2166410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 2178180 - 2178043
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||| |||| ||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2178180 |
aaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataatggtgggaccccttcccggaccc |
2178081 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| |||| |||||||| ||||||||||||||||||||| |
|
|
| T |
2178080 |
tatatattcgggagctttagtgcaccgggttgcccttt |
2178043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 9161123 - 9161259
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||||| ||| |||||||||||||||| |||||||| |
|
|
| T |
9161123 |
aaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaacagagtaaggctgcgtacaatacatcaataatggtgggaccccttctcggaccct |
9161222 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|| ||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
9161223 |
gcgtatgcggaagctttagtgcaccaggttgcccttt |
9161259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 10 - 141
Target Start/End: Complemental strand, 23240957 - 23240826
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||| ||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||| |||| ||| |
|
|
| T |
23240957 |
aaaggtcacaggtgcaagtcctggaaacagcctcttgtgtaaaacagggtaagtttgcgtacaatataccaattggtgggaccccttctaggacaatgcg |
23240858 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgccct |
141 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||| |
|
|
| T |
23240857 |
tatgcgggagctttagtgcactgggctgccct |
23240826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 10 - 144
Target Start/End: Complemental strand, 7947507 - 7947370
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||| ||||||| ||||| ||||| |||| ||||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||||||| | |
|
|
| T |
7947507 |
aaaggtcaccggttcaactcctggaaacaacctcctgtgtaaaaaccagggtaaggctgcgtacaatacaccaaaatggtgggcccccttcccggacctt |
7947408 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
|| |||| ||||||| |||||||| || ||||||||| |
|
|
| T |
7947407 |
gcgtatgtgggagctttagtgcacttggctgcccttta |
7947370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 8 - 143
Target Start/End: Complemental strand, 18277330 - 18277193
Alignment:
| Q |
8 |
taaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||| || || |||||||||||||||||||| |||||||||| || ||||| |||||||||||||||||||||||| ||| | |
|
|
| T |
18277330 |
taaaaggtcacgggttcaaatcttggaaacagcctcttgtgtaaaaatcagggtaaggttgagtacagaacaccaaatggtgggaccccttcctagactc |
18277231 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| | |||||||||||| || |||||||||||| ||||| |
|
|
| T |
18277230 |
tacgtatgcgggagctttactgcaccgggttgtccttt |
18277193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 10 - 141
Target Start/End: Complemental strand, 15866172 - 15866041
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||||| |||||||| ||||| |||||||||||| |||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15866172 |
aaaggtcatgggttcaattcctggaaacagcctcttaagtaaaaaacagggtaaagctgcgta--atacaccaaatggtgggaccccttcccggaccctg |
15866075 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgccct |
141 |
Q |
| |
|
| | ||||||| || |||||||| | |||||||| |
|
|
| T |
15866074 |
cgtttgcgggatctatagtgcactgagttgccct |
15866041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 20 - 126
Target Start/End: Original strand, 32579436 - 32579543
Alignment:
| Q |
20 |
ggttcaagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggga |
118 |
Q |
| |
|
||||||||||||| ||||||||||| || ||||| | |||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32579436 |
ggttcaagtcctggaaacagcctctggtataaaaatacggtaagcctgcgtacaataccccaaatggtgggaccccttcccagaccctgcatatgcggga |
32579535 |
T |
 |
| Q |
119 |
gctctagt |
126 |
Q |
| |
|
||| |||| |
|
|
| T |
32579536 |
gctttagt |
32579543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 14 - 136
Target Start/End: Complemental strand, 3815208 - 3815084
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacag--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcata |
111 |
Q |
| |
|
||||||||||||||||||| |||||| || |||||||||| | |||| | |||||||||||||||||||||||||||||| |||||| ||||| | || |
|
|
| T |
3815208 |
gtcacgggttcaagtcctggaaacagactattgtgtaaaaaatatggtacgactgcgtacaatacaccaaatggtgggaccctttcccgaaccctacgta |
3815109 |
T |
 |
| Q |
112 |
tgcgggagctctagtgcaccgggtt |
136 |
Q |
| |
|
||||| |||| |||||||||||||| |
|
|
| T |
3815108 |
tgcggaagctttagtgcaccgggtt |
3815084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 15 - 132
Target Start/End: Original strand, 33138838 - 33138957
Alignment:
| Q |
15 |
tcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatat |
112 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||| ||| ||||||| |||||||||||||||||||||||||||| || |||||||||| ||| |
|
|
| T |
33138838 |
tcacgggttcaagtcctggaaacaacctcttgtataaaaaacagagtaaggccgcgtacaatacaccaaatggtgggacccttttccggaccctgtgtat |
33138937 |
T |
 |
| Q |
113 |
gcgggagctctagtgcaccg |
132 |
Q |
| |
|
|| | |||| |||||||||| |
|
|
| T |
33138938 |
gcagtagctttagtgcaccg |
33138957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 10 - 144
Target Start/End: Original strand, 12889426 - 12889563
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||| ||||||||| |||||||| ||||||||||| ||| | ||||||||||| ||||||||| |
|
|
| T |
12889426 |
aaaggtcacaggttcaagtcttgaaaacagcctcttgtgttaaaaacagggcaaggctgcatacaatacacctaaacgatgggacccctttccggaccct |
12889525 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
| || ||||||| ||||||| |||| ||||||||| |
|
|
| T |
12889526 |
ctgtgtgtgggagctttagtgcatcgggctgcccttta |
12889563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 65 - 143
Target Start/End: Complemental strand, 23930205 - 23930127
Alignment:
| Q |
65 |
tgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
23930205 |
tgcgtacaatacaccagatggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgcccttt |
23930127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 65 - 143
Target Start/End: Original strand, 12892064 - 12892144
Alignment:
| Q |
65 |
tgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12892064 |
tgcgtataatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
12892144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 71 - 143
Target Start/End: Original strand, 13267788 - 13267860
Alignment:
| Q |
71 |
caatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
13267788 |
caatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgcccttt |
13267860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 1941856 - 1941990
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||| ||| || ||||| || ||||| |||||||||||||| |||||||||||||||||||||||||| |||||||||||||| ||| ||| | || |
|
|
| T |
1941856 |
aaggtcgcggattgaagtcatgtaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccatcctggatcttgt |
1941955 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||| | | |||||||| |||||||||| |
|
|
| T |
1941956 |
gtatgcgggagtttttgtgcaccgtgttgcccttt |
1941990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 24097581 - 24097712
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||||||| ||| ||||||| || ||||||||||| ||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24097581 |
aaaggtcacgagtttaagtcctcgaaccagcctcttgtataaaaaacagggtaaggctgcttacaa----ccaaatggtgggaccccttcccggaccctg |
24097676 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| ||||||| |||| ||||| || ||||||||||| |
|
|
| T |
24097677 |
cgtatgcggaagctttagtgtcccaggttgcccttt |
24097712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 10 - 108
Target Start/End: Complemental strand, 13905114 - 13905015
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||| |||||||||||||||||| |||||| ||||||||||| |||||| |||||| |||||| |
|
|
| T |
13905114 |
aaaggtcacgggctcaagtcctgaaaacgacctcttgtgtaaaaaacagggtaaggctgcatacaattcaccaaatggt-ggaccctttcccgaaccctg |
13905016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 10 - 141
Target Start/End: Complemental strand, 15865991 - 15865859
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||| |||||||| ||||| |||||||||||| |||||| |||||||| |||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
15865991 |
aaaggtcatgggttcaattcctggaaacagcctcttacgtaaaaaaacagggtaaagctgcgta--atacaccaaatggtgggaccccttcctggaccct |
15865894 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgccct |
141 |
Q |
| |
|
|| | |||| || || |||||||| | |||||||| |
|
|
| T |
15865893 |
gcgtttgcgtgatctatagtgcactgagttgccct |
15865859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 66 - 146
Target Start/End: Complemental strand, 383837 - 383757
Alignment:
| Q |
66 |
gcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaat |
146 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| | |||||||| |||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
383837 |
gcgtacaatacaccaaattgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgccctttaat |
383757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 81 - 143
Target Start/End: Original strand, 6808468 - 6808530
Alignment:
| Q |
81 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
6808468 |
aatggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttt |
6808530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 64 - 143
Target Start/End: Original strand, 12885967 - 12886048
Alignment:
| Q |
64 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||| |||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
12885967 |
ctgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgcccttt |
12886048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 11 - 139
Target Start/End: Complemental strand, 14975214 - 14975094
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||| | ||||| |||||||||| ||||||||||||||||||| |||| || |
|
|
| T |
14975214 |
aaggtcacggattcaagtcctggaaacagcctcttgtgtaaaaaac---aaggc-------aatacaccaataatggtgggaccccttcccgaaccccgc |
14975125 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
||||||||||| | ||||||||||||||||| |
|
|
| T |
14975124 |
atatgcgggagttttagtgcaccgggttgcc |
14975094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 11 - 111
Target Start/End: Original strand, 6024234 - 6024338
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||||||| |||||| |||||| ||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
| T |
6024234 |
aaggtcacggtttcaaatcctagaaacagcctcttgtgtaaaaaacatggtaagactgcgtacaatacaccaataatgatgggacctcttcccggacccc |
6024333 |
T |
 |
| Q |
107 |
gcata |
111 |
Q |
| |
|
||||| |
|
|
| T |
6024334 |
gcata |
6024338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 3116258 - 3116129
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||||| ||||||||||| || ||||| |||||||| ||||| | | ||||| ||||||||||||| ||||||||||||||| |||||| || |
|
|
| T |
3116258 |
aaaggtcatgggttcaagtcatggaaacaacctcttgtataaaa------atgactgcgcacaatacaccaaaaatggtgggaccccttctcggaccttg |
3116165 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| |||||||||||| |||| |||||| ||||||||| |
|
|
| T |
3116164 |
cgtatgcgggagctttagtacaccggattgcccttt |
3116129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 10 - 76
Target Start/End: Original strand, 8409243 - 8409311
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatac |
76 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8409243 |
aaaggtcacggattcaagtcctggaaactgcctcttgtgtaaaaaacagggtaaggctgcgtacaatac |
8409311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 10 - 121
Target Start/End: Original strand, 14553511 - 14553626
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||| |||||||| |||| |||||||||||| ||| ||||||||||| ||||||||||||||| ||||| |
|
|
| T |
14553511 |
aaaggtcacaggttcaagtcctggaaatagcttcttgtgtaaaaaatagggtaaggctgtgtataatacaccaaaactggtgggaccccttcgtagaccc |
14553610 |
T |
 |
| Q |
106 |
tgcatatgcgggagct |
121 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
14553611 |
tgtgtatgcgggagct |
14553626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 10 - 145
Target Start/End: Original strand, 17432340 - 17432485
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--------gggtaaggctgcgtacaatacaccaaa--tggtgggaccccttccc |
99 |
Q |
| |
|
||||||||| ||||||||||||| ||||| | |||||||||||| | ||||||||||| ||||||||||| ||| ||||| |||| ||||| |
|
|
| T |
17432340 |
aaaggtcacaggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaagggtaaggctgtgtacaatacactaaaaatggtgagaccttttccc |
17432439 |
T |
 |
| Q |
100 |
ggaccctgcatatgcgggagctctagtgcaccgggttgccctttaa |
145 |
Q |
| |
|
||| |||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17432440 |
ggatcctgtgcatgcgggagctttagtgcaccgggttgccctttaa |
17432485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 75 - 145
Target Start/End: Complemental strand, 10734974 - 10734903
Alignment:
| Q |
75 |
acaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaa |
145 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| |||||||||||| |||| ||||||| |||||||||| |
|
|
| T |
10734974 |
acaccaaagtggtgggcccccttcccggaccctgcgtatgcgggagctttagtccaccgggctgccctttaa |
10734903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 33 - 143
Target Start/End: Complemental strand, 9671197 - 9671084
Alignment:
| Q |
33 |
aaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaataca-ccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
129 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||| |||| | ||||||| ||||||||| ||| |||||||| || |||||||| || |||| |
|
|
| T |
9671197 |
aaaacagcctcttgtgtaaaaaacagggtaaggctgcctactttacatcaaaatggtaggacccctttccgaaccctgcaaatacgggagctttaatgca |
9671098 |
T |
 |
| Q |
130 |
ccgggttgcccttt |
143 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
9671097 |
tcgggctgcccttt |
9671084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 69 - 119
Target Start/End: Original strand, 22967237 - 22967287
Alignment:
| Q |
69 |
tacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
22967237 |
tacaatacaccaaatggtgggaccccttcttggaccctgcctatgcgggag |
22967287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 69 - 119
Target Start/End: Complemental strand, 23821156 - 23821106
Alignment:
| Q |
69 |
tacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
23821156 |
tacaatacaccaaatggtgggaccccttcttggaccctgcctatgcgggag |
23821106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 37 - 134
Target Start/End: Original strand, 19340855 - 19340954
Alignment:
| Q |
37 |
cagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
133 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| ||||||||||||| || ||||||||||||| |||||| || ||||||| |||| ||||||| ||| |
|
|
| T |
19340855 |
cagcctcttgtgtaaaaaacagggtaaggttgca-acaatacaccaaaatgatgggaccccttcctggacccggcgtatgcggaagctttagtgcaacgg |
19340953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 50 - 116
Target Start/End: Original strand, 24734684 - 24734752
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgg |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||| | ||| ||||||||||||||||||| ||||| ||||||| |
|
|
| T |
24734684 |
aaaacagggtaaggttgcgtacaatacaacaaaaaaggtgggaccccttcccggatcctgcgtatgcgg |
24734752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 32728291 - 32728157
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||| | ||||||| || ||||| |||||| ||||||| ||||||||| ||| |||||||| ||||||| || || ||| ||||| |||||| |
|
|
| T |
32728291 |
aaaggtcacagattcaagttttggaaacaacctcttatgtaaaaaacagggtaagactgtgtacaatataccaaatagt-ggtccctttcccagacccta |
32728193 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| ||||||||| || ||||||||| |||||||||| |
|
|
| T |
32728192 |
cgtatgcgggaactttagtgcaccatgttgcccttt |
32728157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 133
Target Start/End: Original strand, 11395827 - 11395886
Alignment:
| Q |
75 |
acaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
133 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||| |||||||||||| |||| |||||| |
|
|
| T |
11395827 |
acaccaaagtggtgggaccccttcccggatcctgcgtatgcgggagctttagtccaccgg |
11395886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 143
Target Start/End: Original strand, 25997749 - 25997784
Alignment:
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25997749 |
catatgcgggagctctagtgcaccgggttgcccttt |
25997784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 50 - 142
Target Start/End: Complemental strand, 2755517 - 2755422
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcatat--gcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|||| ||| ||||||||||||||||||||| ||||||||||| ||||||| | ||||||||| ||||||||| ||||||||| |||||||||| |
|
|
| T |
2755517 |
aaaataggctaaggctgcgtacaatacaccaaaaatggtgggagtccttcccaaatcctgcatatgcgcgggagctttagtgcacc-ggttgccctt |
2755422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 73
Target Start/End: Original strand, 17448324 - 17448389
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaa |
73 |
Q |
| |
|
||||||||||||||||||| |||||||| | | |||||| |||||||||||||||||||||||| |
|
|
| T |
17448324 |
aaaggtcacgggttcaagttttgaaaacaacattttgtgtaaaaaacagggtaaggctgcgtacaa |
17448389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 8 - 70
Target Start/End: Complemental strand, 4136654 - 4136590
Alignment:
| Q |
8 |
taaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgta |
70 |
Q |
| |
|
||||| |||||||||||||||||| |||||| | ||||||||||| ||||||||||| |||||| |
|
|
| T |
4136654 |
taaaatgtcacgggttcaagtcctaaaaacaacatcttgtgtaaaatacagggtaaggttgcgta |
4136590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 113
Target Start/End: Original strand, 11849063 - 11849159
Alignment:
| Q |
20 |
ggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatg |
113 |
Q |
| |
|
||||||||||| | ||||| |||||||||| |||||||| ||| | ||| ||||||||||||| |||||||||||||||||| || |||| |||| |
|
|
| T |
11849063 |
ggttcaagtccaggaaacaacctcttgtgttaaaaacaggataaagttgcccacaatacaccaaaatggtgggaccccttcccgaactctgcgtatg |
11849159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 132
Target Start/End: Original strand, 20400667 - 20400791
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||| ||||||||| || ||||| ||||||||||||| ||||||||| ||||||||| ||||| |||| | ||||||| || ||| ||||| |
|
|
| T |
20400667 |
aaaggtcacaggttcaagttatggaaacaatctcttgtgtaaaaaacagggtaagactgcgtacagtacactaaatagcgggacccttttccgaacccta |
20400766 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccg |
132 |
Q |
| |
|
| ||||| | | || |||||||||| |
|
|
| T |
20400767 |
cgtatgcagaaactttagtgcaccg |
20400791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 90 - 139
Target Start/End: Complemental strand, 30786427 - 30786378
Alignment:
| Q |
90 |
accccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
||||||||| ||||| ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
30786427 |
accccttcctggaccgtgcgtatgcgggagctttagtgcaccgggttgcc |
30786378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 84 - 143
Target Start/End: Complemental strand, 33922916 - 33922857
Alignment:
| Q |
84 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||| ||||||||||||||||||| |||| |||||| |||||||| ||||||||||| |
|
|
| T |
33922916 |
ggtggcaccccttcccggaccctgcttatgttggagctttagtgcacatggttgcccttt |
33922857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 144
Target Start/End: Complemental strand, 16895761 - 16895695
Alignment:
| Q |
80 |
aaatggtgggacccc-ttcccggaccctgcatatgcgggagctctagtgcaccggg-ttgcccttta |
144 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||| || || | |||||||||||| |||||||||| |
|
|
| T |
16895761 |
aaatggtgggacccccttcccggaccctacatatgtggaagttttagtgcaccgggtttgcccttta |
16895695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 50 - 79
Target Start/End: Complemental strand, 14341163 - 14341134
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacacc |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14341163 |
aaaacagggtaaggctgcgtacaatacacc |
14341134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 95)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 9832446 - 9832313
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9832446 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
9832347 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||| |
|
|
| T |
9832346 |
tatgcaggaactctagtgcaccgggttgcccttt |
9832313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 20224984 - 20225117
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20224984 |
aaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
20225083 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
20225084 |
tatgcgggagctctagtgcaccgggttgcccttt |
20225117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 48598958 - 48598825
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48598958 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccatgca |
48598859 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
48598858 |
tatgccggagctctagtgcaccgggttgcccttt |
48598825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 10 - 141
Target Start/End: Complemental strand, 29208031 - 29207900
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29208031 |
aaaggtcacgggttcaagtcctggaaattgcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
29207932 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgccct |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29207931 |
tatgcgggagctctagtgcaccgggttgccct |
29207900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 11054281 - 11054148
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
11054281 |
aaaggtcacgggttcaagtcctgaaaacagtctcttgtgtaaaacagggtaagactgcgtacaatacaccaaatggcggaaccccttcccggaccctgca |
11054182 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11054181 |
tatgcgggagctctagtgcaccgggttgcccttt |
11054148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 47528663 - 47528530
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47528663 |
aaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgaa |
47528564 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
47528563 |
tatgtgggagctctagtgcaccgggttgcccttt |
47528530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 5648260 - 5648393
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5648260 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcg |
5648359 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| |
|
|
| T |
5648360 |
tatgcgggagcttcagtgcactgggttgcccttt |
5648393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 30639380 - 30639514
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||| ||||||||||||| |||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30639380 |
aaaggtcactggttcaagtcctggaaacagactcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgagaccccttcccggaccctgc |
30639479 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||| |
|
|
| T |
30639480 |
atatgcgggagctttagtgcactgggttgcccttt |
30639514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 10 - 142
Target Start/End: Complemental strand, 6430760 - 6430627
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6430760 |
aaaggtcacgggttcaagtcatggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccacttcccggaccctgc |
6430661 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |
|
|
| T |
6430660 |
gtatgcgggagctttagcgcaccgggttgccctt |
6430627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 10 - 139
Target Start/End: Complemental strand, 39077929 - 39077800
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||| ||| |||||||||||| |
|
|
| T |
39077929 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggttgcgtacaatataccaaatggtgagacatctttccggaccctgca |
39077830 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39077829 |
tatgcgggagctctagtgcaccgggttgcc |
39077800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 47443957 - 47444092
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47443957 |
aaaggtcacgggttcaagtcctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
47444056 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||| |||||| ||||||| |||||||||||| |
|
|
| T |
47444057 |
catatgcaggagcttcagtgcactgggttgcccttt |
47444092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 11 - 142
Target Start/End: Original strand, 40915830 - 40915962
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40915830 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggagcccttcccggaccctgcg |
40915929 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|||||||||||| |||||||||| |||||||| |
|
|
| T |
40915930 |
tatgcgggagcttcagtgcaccggattgccctt |
40915962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 16408737 - 16408601
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
16408737 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaataatggtggaaccccttcccggacccc |
16408638 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16408637 |
gcatatgcgggagctttagtgcaccgggttgcccttt |
16408601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 5306798 - 5306660
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5306798 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaatcagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
5306699 |
T |
 |
| Q |
109 |
atatg----cgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||| |||||||| || |||||||||||||||||| |
|
|
| T |
5306698 |
gtatgtggacgggagctttaatgcaccgggttgcccttt |
5306660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 18 - 142
Target Start/End: Complemental strand, 8473747 - 8473621
Alignment:
| Q |
18 |
cgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggacccctt-cccgga-ccctgcatatgcg |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
8473747 |
cgggttcaagtcctggaaacagcctcttgtgtttaacagggtaaggctgcatacaatacaccaaatggtgggaccccttccccggacccctgcatatgcg |
8473648 |
T |
 |
| Q |
116 |
ggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|||||| |||||||||||||||||||| |
|
|
| T |
8473647 |
ggagctttagtgcaccgggttgccctt |
8473621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 14 - 143
Target Start/End: Original strand, 54175067 - 54175200
Alignment:
| Q |
14 |
gtcacgggttcaagtcctg-aaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttccc-ggaccctgca |
109 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
54175067 |
gtcacggattcaagtcctggaaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttccccggaccctgca |
54175166 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| |
|
|
| T |
54175167 |
tatgcgggagctttagtgcaccgggctgcccttt |
54175200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 27 - 143
Target Start/End: Complemental strand, 20639777 - 20639658
Alignment:
| Q |
27 |
gtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctct |
123 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
20639777 |
gtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagcttt |
20639678 |
T |
 |
| Q |
124 |
agtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
20639677 |
agtgcaccgggttgcccttt |
20639658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 10 - 144
Target Start/End: Complemental strand, 44363267 - 44363129
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccc |
105 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||| ||||||| |||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
44363267 |
aaaggtcacgagttcaagtcctgaaaacagcctcgtgtgtaaaaaacagggtagggctgcgtacaacgcaccaaaaatggtgggaccccttcccggaccc |
44363168 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
44363167 |
tgcgtatgcgggagctttagtgcaccgggttgcccttta |
44363129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 10 - 121
Target Start/End: Complemental strand, 17043529 - 17043416
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17043529 |
aaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccagaccctg |
17043430 |
T |
 |
| Q |
108 |
catatgcgggagct |
121 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
17043429 |
catatgctggagct |
17043416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 23501793 - 23501924
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccc |
105 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23501793 |
aaaggtcacgggttcaagtc------acagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggaccc |
23501886 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23501887 |
tgcatatgcgggagctttagtgcaccgggttgcccttt |
23501924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 16911562 - 16911699
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccc |
105 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16911562 |
aaaggtcacgggttcaagtcctagaaacagcctcttgtgtacaaatcagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccc |
16911661 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| || ||||||||| |||| ||||||||||||||| |
|
|
| T |
16911662 |
tgcgtacgcgggagctttagtttaccgggttgcccttt |
16911699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 11 - 140
Target Start/End: Original strand, 21646965 - 21647098
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||| | |||||||||||||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
21646965 |
aaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaaggctgcgtacaatataccaataatggtgggaccccttcccagacccc |
21647064 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgccc |
140 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
21647065 |
gcatatgcgggagctttagtgcaccgggttgccc |
21647098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 14 - 143
Target Start/End: Complemental strand, 10277886 - 10277757
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatg |
113 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||| ||| ||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
10277886 |
gtcacgggttcaaatccttgaaacagcctcttgtataaaataggataaggctgcgtacaatacaccaaatggtgaaaccccttcccagaccctgcatatg |
10277787 |
T |
 |
| Q |
114 |
cgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||| |
|
|
| T |
10277786 |
cgggagttctagtgaaccggattgcccttt |
10277757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 34 - 143
Target Start/End: Original strand, 25629073 - 25629184
Alignment:
| Q |
34 |
aaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
|||||| ||||||||||||| | ||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
25629073 |
aaacagtctcttgtgtaaaaaatagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctacatatgcgggagctttagtgcacc |
25629172 |
T |
 |
| Q |
132 |
gggttgcccttt |
143 |
Q |
| |
|
|||||||||||| |
|
|
| T |
25629173 |
gggttgcccttt |
25629184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 35567170 - 35567305
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||||| ||||||||||| || |||||||| ||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
35567170 |
aaaggtcatgggttcaagtcttggaaacagccacttgtgtaaaaaacagggtaaggctgtgtacaacacaccaaatggtgggaccccttcccgaaccctg |
35567269 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| | |||||||||| |||||||||||| |||||||| |
|
|
| T |
35567270 |
cgtctgcgggagctttagtgcaccgggctgcccttt |
35567305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 10 - 144
Target Start/End: Complemental strand, 30690318 - 30690175
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---------cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccg |
100 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
30690318 |
aaaggtcacgggttcaagtcctggaaaaagcctcttgtgtaaaaaataaaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttcccg |
30690219 |
T |
 |
| Q |
101 |
gaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
|||||||| |||||||||||| ||||||||| || ||||||||| |
|
|
| T |
30690218 |
gaccctgcgtatgcgggagctttagtgcaccaggctgcccttta |
30690175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 10 - 121
Target Start/End: Original strand, 25463122 - 25463235
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||| | ||| |||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25463122 |
aaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaactgggaaaggttgcgtacaacacaccaaatggtgggaccccttcccggaccctg |
25463221 |
T |
 |
| Q |
108 |
catatgcgggagct |
121 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
25463222 |
catatgcgggagct |
25463235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 10 - 133
Target Start/End: Original strand, 19027848 - 19027973
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||||||||| ||||| | |||||||||||| |||||||||||||||||||||||||||| |||||||||||||| || ||| ||| |
|
|
| T |
19027848 |
aaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaattggtgggacccctttccagactctg |
19027947 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgg |
133 |
Q |
| |
|
| |||| ||||||| ||||||||||| |
|
|
| T |
19027948 |
cgtatgtgggagctttagtgcaccgg |
19027973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 53 - 144
Target Start/End: Original strand, 20225119 - 20225212
Alignment:
| Q |
53 |
acagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20225119 |
acagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttta |
20225212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 28 - 142
Target Start/End: Complemental strand, 7909397 - 7909281
Alignment:
| Q |
28 |
tcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgc-gggagctctag |
125 |
Q |
| |
|
||||| |||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||||| ||| |
|
|
| T |
7909397 |
tcctggaaacagtctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcggggagctttag |
7909298 |
T |
 |
| Q |
126 |
tgcaccgggttgccctt |
142 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
7909297 |
tgcatcgggttgccctt |
7909281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 34 - 143
Target Start/End: Complemental strand, 51865149 - 51865038
Alignment:
| Q |
34 |
aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| || |||||| |
|
|
| T |
51865149 |
aaacagcctcttgtgtaaaaaacatggtaaggctgcgtacaatacaccaaatggtggggccccttcccggaccctgcgtatgcgggagctttattgcacc |
51865050 |
T |
 |
| Q |
132 |
gggttgcccttt |
143 |
Q |
| |
|
|| |||||||| |
|
|
| T |
51865049 |
ggactgcccttt |
51865038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 14983835 - 14983969
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||| |||||||| | |||||||||||||||||||| | |||||||| ||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14983835 |
aaggtcacggattcaagtctttgaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatggtgggaccccttcccggaccctgc |
14983934 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||| |
|
|
| T |
14983935 |
gtatgcgggagctttagtgtaccatgttgcccttt |
14983969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 72 - 143
Target Start/End: Original strand, 38786673 - 38786744
Alignment:
| Q |
72 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38786673 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
38786744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 22 - 139
Target Start/End: Complemental strand, 9987957 - 9987838
Alignment:
| Q |
22 |
ttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
119 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
9987957 |
ttcaagtcctggaaacaacctcttgtgtaaacaatagggtaaggctgcatacaatacaccaaatggtgggaccccttccttgaccttgcatatgcgggag |
9987858 |
T |
 |
| Q |
120 |
ctctagtgcaccgggttgcc |
139 |
Q |
| |
|
|| || ||||||||| |||| |
|
|
| T |
9987857 |
ctttaatgcaccgggctgcc |
9987838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 34 - 121
Target Start/End: Original strand, 49796822 - 49796910
Alignment:
| Q |
34 |
aaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
121 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
49796822 |
aaacagcctcttgtgttaaaacatggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagct |
49796910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 38 - 143
Target Start/End: Complemental strand, 13256508 - 13256399
Alignment:
| Q |
38 |
agcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
133 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| || |||||||||||||||| |||| |||| |||||||||| ||||||||||| |
|
|
| T |
13256508 |
agcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgg |
13256409 |
T |
 |
| Q |
134 |
gttgcccttt |
143 |
Q |
| |
|
|||||||||| |
|
|
| T |
13256408 |
gttgcccttt |
13256399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 9 - 132
Target Start/End: Original strand, 54730248 - 54730376
Alignment:
| Q |
9 |
aaaaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggac |
103 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||| ||| |||||||||||| ||||||||| |||| ||| |||||||||||||| |
|
|
| T |
54730248 |
aaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaaataggataaggctgcgtataatacaccaataatgatggaaccccttcccggac |
54730347 |
T |
 |
| Q |
104 |
cctgcatatgcgggagctctagtgcaccg |
132 |
Q |
| |
|
||||| |||||||||||| |||||||||| |
|
|
| T |
54730348 |
cctgcgtatgcgggagctttagtgcaccg |
54730376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 10 - 132
Target Start/End: Complemental strand, 30496455 - 30496333
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||||| ||||||||| || ||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||| |||||||||||| ||| |
|
|
| T |
30496455 |
aaaggtcacgtgttcaagtcatggaaacagcctcttgtgtaaacacgggtaaggctgcatacaatacaccaaatggggggactccttcccggaccgtgct |
30496356 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccg |
132 |
Q |
| |
|
|||| |||||| |||||||||| |
|
|
| T |
30496355 |
tatgatggagctttagtgcaccg |
30496333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 10 - 129
Target Start/End: Original strand, 37494851 - 37494972
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||| ||||||||||||| ||||| |||||||||||||| |||||||||| ||| ||||||| |||||||||||||||||||| | |||||||| |
|
|
| T |
37494851 |
aaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggttgcatacaatataccaaatggtgggacccctttcgggaccctg |
37494950 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgca |
129 |
Q |
| |
|
| ||||| |||||| ||||||| |
|
|
| T |
37494951 |
cgtatgcaggagctttagtgca |
37494972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 30581604 - 30581481
Alignment:
| Q |
8 |
taaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggac |
103 |
Q |
| |
|
|||||||||| ||||||||||| || ||||| |||||||||||||| |||||||||| || ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30581604 |
taaaaggtcaagggttcaagtcgtggaaacaacctcttgtgtaaaaaaacagggtaagggtgtgtacaatacaccaaaatggtgggaccccttcccggac |
30581505 |
T |
 |
| Q |
104 |
cctgcatatgcgggagctctagtg |
127 |
Q |
| |
|
|||||||||| |||||| ||||| |
|
|
| T |
30581504 |
cctgcatatgtaggagctttagtg |
30581481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 12 - 144
Target Start/End: Complemental strand, 32478918 - 32478791
Alignment:
| Q |
12 |
aggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcat |
110 |
Q |
| |
|
||||||| ||||||||||||| ||||| ||||| |||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| || | |
|
|
| T |
32478918 |
aggtcacaggttcaagtcctggaaacaacctctagtgtaaaaacagggtaaggctg-----aatacaccaaatggtgggaccccttcccggacccagcgt |
32478824 |
T |
 |
| Q |
111 |
atgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||||||||||| | ||||||||||| |||||||| |
|
|
| T |
32478823 |
atgcgggagct-ttgtgcaccgggtggcccttta |
32478791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 10 - 130
Target Start/End: Complemental strand, 41018928 - 41018807
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||||| |||| ||| |
|
|
| T |
41018928 |
aaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaattagggtaaggctacgtacaatacaccaaatagtgggaccccttcccagaccttgc |
41018829 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcac |
130 |
Q |
| |
|
|||| || ||| |||||||| |
|
|
| T |
41018828 |
gtatggaggggctttagtgcac |
41018807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 30352726 - 30352580
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-------cagggtaag----gctgcgtacaatacaccaaa--tggtgggacccctt |
96 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||| ||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
30352726 |
aaaggtcacgggttagagtcctggaaacagcctcttgtgtaaaaaaaaaaacagggtaagtaaagctgcgtacaatacaccaaaaatggtgggacccctt |
30352627 |
T |
 |
| Q |
97 |
cccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| |||||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
30352626 |
ctcggaccctgcgtatgcgggagctttagtgcaccgtgttgcccttt |
30352580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 10 - 120
Target Start/End: Complemental strand, 7385611 - 7385499
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||| | |||||||| || || ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7385611 |
aaaggtcacgggttcaagccctggaaacagcctcatgtgtaaaaaatagggtaaggttgtgtgcaatacaccaaatggtgggaccctttcccggaccctg |
7385512 |
T |
 |
| Q |
108 |
catatgcgggagc |
120 |
Q |
| |
|
||||||||||| |
|
|
| T |
7385511 |
tgtatgcgggagc |
7385499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 34 - 143
Target Start/End: Original strand, 20405110 - 20405224
Alignment:
| Q |
34 |
aaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgc |
128 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||| || |||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
20405110 |
aaacagcctcttgtgtaaaaaaacagggtaagattgcgtacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgc |
20405209 |
T |
 |
| Q |
129 |
accgggttgcccttt |
143 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
20405210 |
attgggttgcccttt |
20405224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 8 - 121
Target Start/End: Complemental strand, 39029198 - 39029082
Alignment:
| Q |
8 |
taaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggacc |
104 |
Q |
| |
|
|||||||||| |||||||| | || |||||||||||||||||||| ||||||||||||| ||||||||||| ||| |||||||||| ||| ||||||| |
|
|
| T |
39029198 |
taaaaggtcataggttcaagccttggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacgaaaatggtgggaccactttccggacc |
39029099 |
T |
 |
| Q |
105 |
ctgcatatgcgggagct |
121 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
39029098 |
ctgcatatgcgggagct |
39029082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 22 - 138
Target Start/End: Original strand, 21489099 - 21489218
Alignment:
| Q |
22 |
ttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcggga |
118 |
Q |
| |
|
||||||||||| ||||||||||||| |||||| ||| ||||| ||||||||||| ||||||| |||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
21489099 |
ttcaagtcctggaaacagcctcttgcgtaaaaaacagagtaagactgcgtacaatgcaccaaaatggtgggaccccttcccgaaccctgcgtatgcggga |
21489198 |
T |
 |
| Q |
119 |
gctctagtgcaccgggttgc |
138 |
Q |
| |
|
||| | |||||| ||||||| |
|
|
| T |
21489199 |
gctttcgtgcactgggttgc |
21489218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 10 - 121
Target Start/End: Complemental strand, 49938725 - 49938615
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||| ||||| ||||||| | |||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
49938725 |
aaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaacggggtaag---gtgtacaatacaccaaaatggtgggaccccttcccataccctg |
49938629 |
T |
 |
| Q |
108 |
catatgcgggagct |
121 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
49938628 |
catatgcgggagct |
49938615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 55766600 - 55766466
Alignment:
| Q |
11 |
aaggtcacggg-ttcaagtcctgaaaacagcctcttgtgta-aaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||| ||||||| || |||||| |||||||| |||||||||||||||||||||||||||| |||||||| ||||| ||||||||| ||| |
|
|
| T |
55766600 |
aaggtcacggggttcaagttttggaaacagtttcttgtgtgtaaacagggtaaggctgcgtacaatacactgaatggtggaaccccatcccggaccttgc |
55766501 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||| ||||| |||||||||||| |||||||| |
|
|
| T |
55766500 |
gtatgcgagagctttagtgcaccgggatgcccttt |
55766466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 82 - 143
Target Start/End: Original strand, 32484307 - 32484368
Alignment:
| Q |
82 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32484307 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
32484368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 140
Target Start/End: Original strand, 54967021 - 54967151
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||| |||||||| ||| ||| | |||||||||||||| |||||||||| ||| ||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
54967021 |
aaaggtcacatgttcaagttctggaaagaacctcttgtgtaaaaaacagggtaaggttgc-tacaatataccaaatggtgggaccccttcccgtacccta |
54967119 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgccc |
140 |
Q |
| |
|
|||||||||||||| | |||||||||| ||||| |
|
|
| T |
54967120 |
catatgcgggagct-ttgtgcaccgggctgccc |
54967151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 81 - 145
Target Start/End: Complemental strand, 38755970 - 38755906
Alignment:
| Q |
81 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaa |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38755970 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaa |
38755906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 10 - 107
Target Start/End: Complemental strand, 47441665 - 47441566
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||| ||||||||||| |||||| ||||| ||||||| ||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47441665 |
aaaggtcacaggttcaagtccaagaaacagtctcttttgtaaaaatcagggtaaggctgtgtacaatacaccaaatggttggaccccttcccggaccctg |
47441566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 57 - 143
Target Start/End: Complemental strand, 20908723 - 20908636
Alignment:
| Q |
57 |
ggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| ||||||| |||||||||||| |||||||| || |||||||| |
|
|
| T |
20908723 |
ggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacaaggctgcccttt |
20908636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 79 - 145
Target Start/End: Original strand, 11394923 - 11394989
Alignment:
| Q |
79 |
caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaa |
145 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11394923 |
caaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaa |
11394989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 79 - 145
Target Start/End: Original strand, 11404650 - 11404716
Alignment:
| Q |
79 |
caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaa |
145 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11404650 |
caaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaa |
11404716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 55830855 - 55830721
Alignment:
| Q |
11 |
aaggtcacgg-gttcaagtcctgaaaacagcctcttgtgta-aaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||| |||||||| || |||||| ||||||||| ||||||||||| |||||||||||||||| |||||||| ||||| ||||||||| ||| |
|
|
| T |
55830855 |
aaggtcacggagttcaagttttggaaacagtctcttgtgtgtaaacagggtaatgctgcgtacaatacactgaatggtggaaccccatcccggaccttgc |
55830756 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||| ||||| ||||||||| || |||||||| |
|
|
| T |
55830755 |
gtatgcgagagctttagtgcaccaggatgcccttt |
55830721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 7038053 - 7038187
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| |||||||| |||| |||||||| || ||||||||||||| |||||||||| | ||| |||||||||| |
|
|
| T |
7038053 |
aaaggtcacaggttcaagtcctg-aaacagcttcttgtgtaaaaaatagggtaagacttcgtacaatacaccaaaatggtggggcacctacccggaccct |
7038151 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|| ||| | |||||| |||||||| |||||||||||| |
|
|
| T |
7038152 |
gcgtatac-ggagctttagtgcactgggttgcccttt |
7038187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 69 - 143
Target Start/End: Complemental strand, 33836563 - 33836487
Alignment:
| Q |
69 |
tacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||| ||||||||||||| |
|
|
| T |
33836563 |
tacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgcccttt |
33836487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 82 - 146
Target Start/End: Complemental strand, 40553998 - 40553934
Alignment:
| Q |
82 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaat |
146 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40553998 |
atggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaat |
40553934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 50 - 143
Target Start/End: Complemental strand, 36816478 - 36816384
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaat-ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| |||||||| |||||| |||||||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
36816478 |
aaaacagggcagggctgcgtacaatacaccaaaaaggtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgcccttt |
36816384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 40 - 121
Target Start/End: Complemental strand, 3580945 - 3580862
Alignment:
| Q |
40 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
121 |
Q |
| |
|
|||||||||||||| || |||||||||| || |||||||||||||| | |||||||||||||||||||||||||| ||||||| |
|
|
| T |
3580945 |
cctcttgtgtaaaaaccatggtaaggctgtgtgcaatacaccaaatgctaggaccccttcccggaccctgcatatgtgggagct |
3580862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 79 - 139
Target Start/End: Original strand, 28494222 - 28494282
Alignment:
| Q |
79 |
caaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28494222 |
caaatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcaccgggctgcc |
28494282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 10 - 92
Target Start/End: Original strand, 14590837 - 14590922
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggacc |
92 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| ||||| |||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
14590837 |
aaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacagggtaaggctgcatacaatacatcaaatggtgggacc |
14590922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 81 - 144
Target Start/End: Original strand, 25388249 - 25388312
Alignment:
| Q |
81 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||||| |
|
|
| T |
25388249 |
aatggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgcccttta |
25388312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 50 - 144
Target Start/End: Complemental strand, 48327858 - 48327762
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| ||||||||||| ||||||| |||| ||||||||| || | |||||||||||||| ||||||| |
|
|
| T |
48327858 |
aaaacagggtaagactgcatacaatacaccaataatggtgggacctcttcccgaaccccacatatgcggaagttttagtgcaccgggttacccttta |
48327762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 134
Target Start/End: Complemental strand, 487270 - 487135
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtg--taaaacagggtaaggctgcgtacaatacaccaa---------atggtgggaccccttcc |
98 |
Q |
| |
|
|||||||||||||||||||| || ||||| ||||||||| ||||||| ||||| |||||||||||||||| || |||| |||||||||||| |
|
|
| T |
487270 |
aaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaaacaaggtaaagctgcgtacaatacactaaaatggtgggatggcgggaccccttcc |
487171 |
T |
 |
| Q |
99 |
cggaccctgcatatgcgggagctctagtgcaccggg |
134 |
Q |
| |
|
|||| |||| ||||||||||| |||||||||||| |
|
|
| T |
487170 |
cggattctgcgaatgcgggagctttagtgcaccggg |
487135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 140
Target Start/End: Original strand, 36589753 - 36589876
Alignment:
| Q |
20 |
ggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgg |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||| ||||| |||| ||| |||||| ||||||||||||||||||| | ||||| ||||||| |
|
|
| T |
36589753 |
ggttcaagtcctggaaacagcctcttgtgtaaaaaacatggtaatgctgttgacagtacaccaaaatggtgggaccccttcctgaaccctatgtatgcgg |
36589852 |
T |
 |
| Q |
117 |
gagctctagtgcaccgggttgccc |
140 |
Q |
| |
|
||||| | |||||||||| ||||| |
|
|
| T |
36589853 |
gagctttggtgcaccgggctgccc |
36589876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 10 - 119
Target Start/End: Complemental strand, 32629403 - 32629293
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgt-gtaaaacagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| ||||||||||||||| || ||| |||||||||| ||| |||||||||||||||||| || |
|
|
| T |
32629403 |
aaaggtcacgggttcaaatcctcgaaacagcctcttgtaaaaaaacagggtaaggccgcctac-atacaccaaattggcgggaccccttcccggaccttg |
32629305 |
T |
 |
| Q |
108 |
catatgcgggag |
119 |
Q |
| |
|
| |||| ||||| |
|
|
| T |
32629304 |
cgtatgtgggag |
32629293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 12 - 140
Target Start/End: Original strand, 25343189 - 25343321
Alignment:
| Q |
12 |
aggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacc--aaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||| ||||||||| ||| ||| || ||||||||||||| |||||||||||||||||||||||||| ||| ||| ||||||||||| || |||| |
|
|
| T |
25343189 |
aggtcacaggttcaagttctggaaatagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaagggttggaccccttcctagatcctg |
25343288 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgccc |
140 |
Q |
| |
|
| |||| | ||||| ||| ||||| || ||||| |
|
|
| T |
25343289 |
cgtatgtgagagctttagagcacccggctgccc |
25343321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 93 - 143
Target Start/End: Original strand, 35532077 - 35532127
Alignment:
| Q |
93 |
ccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
35532077 |
ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
35532127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 82 - 144
Target Start/End: Original strand, 44718641 - 44718703
Alignment:
| Q |
82 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||| ||| ||||||||||||||||| |
|
|
| T |
44718641 |
atggtgggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgcccttta |
44718703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 50 - 142
Target Start/End: Complemental strand, 12711542 - 12711450
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||| ||||||||||| | |||| || ||||||| | || ||||||||| ||||||||| |
|
|
| T |
12711542 |
aaaatagggtaagactgcgtacaatacaccaaatggcgggaccccttctcagacctagcgtatgcggaaactttagtgcacccagttgccctt |
12711450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 134
Target Start/End: Original strand, 16494258 - 16494345
Alignment:
| Q |
49 |
taaaacagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
134 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||||||||||| ||||| ||||||| ||||||| |||| ||||| |||||| |
|
|
| T |
16494258 |
taaaacagggtaaagctgcatacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcggaagctttagtgtaccggg |
16494345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 52 - 143
Target Start/End: Original strand, 2813169 - 2813263
Alignment:
| Q |
52 |
aacagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctct-agtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||| |||||||||||||| || ||||||||||||| |||||| || ||| |||||||||||| | |||||||||| ||||||||| |
|
|
| T |
2813169 |
aacagggtaagactgcgtacaatacatcaataatggtgggaccctttcccgaacgatgcgtatgcgggagctttaagtgcaccggattgcccttt |
2813263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 10 - 68
Target Start/End: Complemental strand, 42164283 - 42164224
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcg |
68 |
Q |
| |
|
|||||||||||||||||||| || ||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
42164283 |
aaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaacagggtaaggctgcg |
42164224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 80 - 143
Target Start/End: Complemental strand, 47482913 - 47482850
Alignment:
| Q |
80 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| | ||||| || | |||||||| |
|
|
| T |
47482913 |
aaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcaacgagctgcccttt |
47482850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 92 - 143
Target Start/End: Original strand, 56322984 - 56323035
Alignment:
| Q |
92 |
cccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||| | ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
56322984 |
cccttcccggaccccggatatgcgggagctttagtgcaccgggttgcccttt |
56323035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 21 - 140
Target Start/End: Original strand, 10660415 - 10660538
Alignment:
| Q |
21 |
gttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgg |
116 |
Q |
| |
|
|||||||||||| ||||| |||||| ||| |||| |||||| |||||| |||||||||||| ||||||| |||||||||| || ||||| ||||||| |
|
|
| T |
10660415 |
gttcaagtcctggaaacaacctcttatgtaaaaaatagggtatggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgg |
10660513 |
T |
 |
| Q |
117 |
gagctct-agtgcaccgggttgccc |
140 |
Q |
| |
|
||||| | |||||| |||||||||| |
|
|
| T |
10660514 |
gagctttaagtgcatcgggttgccc |
10660538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 21 - 140
Target Start/End: Original strand, 10874560 - 10874683
Alignment:
| Q |
21 |
gttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgg |
116 |
Q |
| |
|
|||||||||||| ||||| |||||| ||| |||| |||||| |||||| |||||||||||| ||||||| |||||||||| || ||||| ||||||| |
|
|
| T |
10874560 |
gttcaagtcctggaaacaacctcttatgtaaaaaatagggtatggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgg |
10874658 |
T |
 |
| Q |
117 |
gagctct-agtgcaccgggttgccc |
140 |
Q |
| |
|
||||| | |||||| |||||||||| |
|
|
| T |
10874659 |
gagctttaagtgcatcgggttgccc |
10874683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 81 - 143
Target Start/End: Complemental strand, 50555718 - 50555656
Alignment:
| Q |
81 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||| |||| | |||||||||||| |||||||| |
|
|
| T |
50555718 |
aatggtggaaccccttcccggaccctgcgtatgcaggagttttagtgcaccgggctgcccttt |
50555656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 23580343 - 23580208
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||||||||||||| || ||| |||||||||||| ||||||||| ||| ||||||| ||||||| |||||| | ||||||||| ||| ||| |
|
|
| T |
23580343 |
aaaggtcacgggttcaagttctagaaagagcctcttgtgtaaaaaacaggggaagactgcgtaggatacaccaaaatggcgagaccccttcttgga-cct |
23580245 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| |||| ||||||| |||||||||| | |||||||| |
|
|
| T |
23580244 |
gtgtatgtgggagctttagtgcaccgagctgcccttt |
23580208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 83 - 143
Target Start/End: Original strand, 19027986 - 19028046
Alignment:
| Q |
83 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||| ||||||||||||| | |||||||||||| |||||||||||| |||||||| |
|
|
| T |
19027986 |
tggtgggactccttcccggaccccacttatgcgggagctttagtgcaccgggctgcccttt |
19028046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 17079777 - 17079691
Alignment:
| Q |
19 |
gggttcaagtcctgaaaacagcctcttgtgta--aaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggac |
103 |
Q |
| |
|
||||||||||| || ||||| ||||||||| ||||||||||||||||| |||||||| | |||||||||||||| |||| |||| |
|
|
| T |
17079777 |
gggttcaagtcttggaaacaatatcttgtgtataaaacagggtaaggctgcatacaatacgctaaatggtgggaccctttcctggac |
17079691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 54640474 - 54640431
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
53 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
54640474 |
aaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaa |
54640431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 50 - 102
Target Start/End: Complemental strand, 35894555 - 35894502
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccgga |
102 |
Q |
| |
|
|||||| |||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35894555 |
aaaacacggtaagtgtgcgtacaatacaccaaaatggtgggaccccttcccgga |
35894502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 22 - 80
Target Start/End: Original strand, 51420586 - 51420646
Alignment:
| Q |
22 |
ttcaagtcctgaaaacagcctcttgtgta--aaacagggtaaggctgcgtacaatacacca |
80 |
Q |
| |
|
|||||||| || ||||| ||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
51420586 |
ttcaagtcatggaaacaacctcttgtgtagaaaacagggtaaggctgggtacaatacacca |
51420646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 67
Target Start/End: Original strand, 43035248 - 43035307
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgta--aaacagggtaaggctgc |
67 |
Q |
| |
|
||||||||||||||||||||| | ||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
43035248 |
aaaggtcacgggttcaagtccaggaaacaacctcttgtgtaagaaacacggtaaggctgc |
43035307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 50 - 120
Target Start/End: Original strand, 46082785 - 46082856
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacacca-aatggtgggaccccttcccggaccctgcatatgcgggagc |
120 |
Q |
| |
|
|||| ||| |||||||||||| |||||| | ||||||| ||| ||||| |||||||||||||||||||||| |
|
|
| T |
46082785 |
aaaataggttaaggctgcgtattatacacaataatggtgagactccttctcggaccctgcatatgcgggagc |
46082856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 100
Target Start/End: Complemental strand, 4222113 - 4222071
Alignment:
| Q |
58 |
gtaaggctgcgtacaatacaccaaatggtgggaccccttcccg |
100 |
Q |
| |
|
||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
4222113 |
gtaaggctgcgtagaatacacaaattggtgggaccccttcccg |
4222071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 67
Target Start/End: Complemental strand, 17315433 - 17315375
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgc |
67 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
17315433 |
aaaggtcacgggttcaattcctcgaaacaacctcttgtgtaaaaacaaggtaaggctgc |
17315375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 56
Target Start/End: Original strand, 41549386 - 41549428
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacag |
56 |
Q |
| |
|
||||||||||||||| ||| ||||| ||||||||||||||||| |
|
|
| T |
41549386 |
gtcacgggttcaagttctggaaacaacctcttgtgtaaaacag |
41549428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 81 - 129
Target Start/End: Original strand, 8820581 - 8820629
Alignment:
| Q |
81 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
129 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||| ||| | ||||||| |
|
|
| T |
8820581 |
aatggtgggaccccttcccagaccctgcgtatgcgagagttttagtgca |
8820629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 89
Target Start/End: Complemental strand, 10380077 - 10379997
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtggg |
89 |
Q |
| |
|
||||||||| ||||||||||| ||||| |||||||||||||| ||| ||| ||||||||||||||||||| ||||| |
|
|
| T |
10380077 |
aaaggtcacttgttcaagtcctacaaacaacctcttgtgtaaaaataggataaaattgcgtacaatacaccaaatagtggg |
10379997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 86 - 142
Target Start/End: Complemental strand, 12666914 - 12666858
Alignment:
| Q |
86 |
tgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
||||||||||| |||||| ||| ||||| |||||| |||| ||||||||||||||| |
|
|
| T |
12666914 |
tgggaccccttgtcggaccatgcgtatgcaggagctttagtacaccgggttgccctt |
12666858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 126; Significance: 5e-65; HSPs: 93)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 34725231 - 34725098
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34725231 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacactaaatggtgggaccccttcccggaccctgca |
34725132 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34725131 |
tatgcgggagctctagtgcaccgggttgcccttt |
34725098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 35253320 - 35253187
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35253320 |
aaagatcacgggttcaagtcctcgaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
35253221 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
35253220 |
tatgcgggagctctagtgcaccggattgcccttt |
35253187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 38478415 - 38478282
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
38478415 |
aaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtggaaccccttctcggaccctgca |
38478316 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38478315 |
tatgcgggagctctagtgcaccgggttgcccttt |
38478282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 19414462 - 19414595
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19414462 |
aaaggtcacgggttcaagtcctagaaagagcctcttatgtaaaacaggttaaggctgcgtacaatacaccaaatggtgggaccccttcccgtaccctgca |
19414561 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19414562 |
tatgcgggagctctagtgcaccgggttgcccttt |
19414595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 10 - 139
Target Start/End: Complemental strand, 45812670 - 45812541
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45812670 |
aaaggtcacaggttcaagtcctgaaaacagtctcttgtgtaaaagagggtaaggctgcatacaatacaccaaatggtgggaccccttcccaaaccctgca |
45812571 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45812570 |
tatgcgggagctctagtgcaccgggttgcc |
45812541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 12126970 - 12126837
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12126970 |
aaaggtcacgggtttaagttctggaaacagcttcttgtgtaaaacagggtaaggctgcgtacaatacaccaaattgtgggaccccttcccggaccctgca |
12126871 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| |||||||| | |||||||||| |
|
|
| T |
12126870 |
tatgcgggagctgtagtgcactgcgttgcccttt |
12126837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 10 - 131
Target Start/End: Original strand, 47214534 - 47214655
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47214534 |
aaaggtcacgggttcaagtcctggaaacagtctcttgtttaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccagaccctgca |
47214633 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcacc |
131 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
47214634 |
tatgcgggagctctagtgcacc |
47214655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 30395862 - 30395726
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30395862 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacccc |
30395763 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
30395762 |
gcatatgcgggagctttagtgcaccgagttgcccttt |
30395726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 32632691 - 32632557
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32632691 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccaaaccctgc |
32632592 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||| |
|
|
| T |
32632591 |
atatgcgggagcttgagtgcaccaggtttcccttt |
32632557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 14617061 - 14617196
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||| ||| ||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14617061 |
aaaggtcacgagttcaagtcctggaaacagcctcttgtgtaaataacaaggtaaggttgcgtacaatacaccaaatggtgggatcccttcccggaccctg |
14617160 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||| |
|
|
| T |
14617161 |
catatgcgggagctttagtgcaccgggttacccttt |
14617196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 14 - 143
Target Start/End: Complemental strand, 46248084 - 46247953
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcata |
111 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46248084 |
gtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgta |
46247985 |
T |
 |
| Q |
112 |
tgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| |
|
|
| T |
46247984 |
tgcgggagctttagtgtaccgggttgcccttt |
46247953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 35005146 - 35005283
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccc |
105 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35005146 |
aaaggtcacgggttcaagtcttgaaaacagcctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccggaccc |
35005245 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
35005246 |
tgcgtatgcgggcgctttagtgcaccgggttgcccttt |
35005283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 11 - 140
Target Start/End: Original strand, 46991828 - 46991959
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46991828 |
aaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccgaatggtgggaccccttcccggaccctgc |
46991927 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgccc |
140 |
Q |
| |
|
|||| ||||||| |||||||||||||||||| |
|
|
| T |
46991928 |
gtatgtgggagctttagtgcaccgggttgccc |
46991959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 10668248 - 10668385
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| || ||||||| ||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
10668248 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggtccc |
10668347 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
10668348 |
tgcgtatgcgggagctttagtgcaccgggttgcccttt |
10668385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 20004226 - 20004090
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||| || ||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
20004226 |
aaggtcacgggttcaagtcctggaaacagcctctcgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagacccc |
20004127 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20004126 |
gcatatgcgggagctttagtgcaccgggttgcccttt |
20004090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 18944666 - 18944804
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||| |||||||| |||| |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18944666 |
aaaggtcacaggttcaaggcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaacaatggtgggaccccttcccggaccc |
18944765 |
T |
 |
| Q |
106 |
tgcatatgcgggagc-tctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| ||||||||||| | ||||||||||||||||||||| |
|
|
| T |
18944766 |
tgcgtatgcgggagcttttagtgcaccgggttgcccttt |
18944804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 50 - 144
Target Start/End: Original strand, 4349703 - 4349797
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
4349703 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta |
4349797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 28 - 143
Target Start/End: Complemental strand, 31382330 - 31382214
Alignment:
| Q |
28 |
tcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagt |
126 |
Q |
| |
|
||||| |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || | |
|
|
| T |
31382330 |
tcctggaaacagcctcttgtgtaaaaacaggataaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcatatgcgggagctttact |
31382231 |
T |
 |
| Q |
127 |
gcaccgggttgcccttt |
143 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
31382230 |
gtaccgggttgcccttt |
31382214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 11 - 139
Target Start/End: Original strand, 6925124 - 6925254
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||| | ||||||||||||| |||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
6925124 |
aaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaatagggtaaggctgcggacaatacaccgaatggtgggaccccttcccggtccctgc |
6925223 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
|||||||||||| |||||||||| |||||| |
|
|
| T |
6925224 |
gtatgcgggagctttagtgcaccgagttgcc |
6925254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 27201670 - 27201807
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa--aacagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccc |
105 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27201670 |
aaaggtcatgggttcaagtcctggaaacagcctcttgtgtcagaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggacct |
27201769 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| |||||||||||| ||||||| |||||||||||| |
|
|
| T |
27201770 |
tgcgtatgcgggagctttagtgcattgggttgcccttt |
27201807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 10 - 121
Target Start/End: Complemental strand, 18724680 - 18724567
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18724680 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaaatcttgggaccccttcccggacccta |
18724581 |
T |
 |
| Q |
108 |
catatgcgggagct |
121 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
18724580 |
catatgcgggagct |
18724567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 11 - 138
Target Start/End: Complemental strand, 23768454 - 23768325
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||| |||||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
23768454 |
aaggtcacaggttcaagtcatggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggacaccttcccagaccctgc |
23768355 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgc |
138 |
Q |
| |
|
|||||||||||| ||||||| ||| |||| |
|
|
| T |
23768354 |
gtatgcgggagctttagtgcagcggattgc |
23768325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 27474304 - 27474438
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||| |||||||||| || |||||| ||||||||||||| ||||| || |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27474304 |
aaaggtcacaggttcaagtcttggaaacagtctcttgtgtaaaaacagggcaaagctgcgtacaatacactgaatggtgggaccccttcccggaccctgc |
27474403 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| |
|
|
| T |
27474404 |
gtatgcgggagctttagtgcaccggattgcccttt |
27474438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 11 - 140
Target Start/End: Original strand, 45402118 - 45402251
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggt--aagg-ctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45402118 |
aaggtaacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggttcaagttctgcgtacaatacaccaaatggtgggaccccttcccagaccct |
45402217 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgccc |
140 |
Q |
| |
|
|| |||||||||||| |||||||||||||||||| |
|
|
| T |
45402218 |
gcgtatgcgggagctttagtgcaccgggttgccc |
45402251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 41319941 - 41319806
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||| |||| |||||||| |||||| ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
41319941 |
aaaggtcacaggtttaagtcctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatgatgggaccccttcccgaaccctt |
41319842 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| | ||||||| |||||||||||| |
|
|
| T |
41319841 |
catatgcgggagtttcagtgcactgggttgcccttt |
41319806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 14 - 121
Target Start/End: Original strand, 11596540 - 11596648
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatat |
112 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
11596540 |
gtcacgggttcaagtcctagaaacaacctcttgtgtaaaaacagggtaaggctgcgtataatacaccaaatggtgggaccccttcctggaccctgcgtat |
11596639 |
T |
 |
| Q |
113 |
gcgggagct |
121 |
Q |
| |
|
||||||||| |
|
|
| T |
11596640 |
gcgggagct |
11596648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 50 - 140
Target Start/End: Complemental strand, 10378828 - 10378738
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
10378828 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgggctgccc |
10378738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 6983944 - 6983811
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||| | | ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6983944 |
aaaggtcacaggttcaagtcctggaaacagcctcgtataaaaaacagggtaagtatgcgtacaatacaccaaatggtgggacccctttccggaccctgcg |
6983845 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|| || |||||| | |||||||||| |||||||| |
|
|
| T |
6983844 |
taggcaggagctttggtgcaccgggctgcccttt |
6983811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 35117903 - 35117765
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgtacaatacacc--aaatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||| |||||||||||||| |||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
35117903 |
aaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaatacagggtaaggctgtgtacaatacaccaaaaatgatgggaccccttcccggaccc |
35117804 |
T |
 |
| Q |
106 |
tgcat-atgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| | |||| |||||| |||||||||||| | |||||| |
|
|
| T |
35117803 |
tgcgtaatgcaggagctttagtgcaccgggcttcccttt |
35117765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 10 - 122
Target Start/End: Complemental strand, 25468398 - 25468284
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||||| |||||||||||||| ||||| |||||||||||||| |||||||||| |||||||||||||||||||||| ||||| |||||| ||||||| |
|
|
| T |
25468398 |
aaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaatcagggtaaggttgcgtacaatacaccaaatggttggacctcttcccagaccctg |
25468299 |
T |
 |
| Q |
108 |
catatgcgggagctc |
122 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
25468298 |
cgtatgcgggagctc |
25468284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 29 - 143
Target Start/End: Original strand, 23796507 - 23796623
Alignment:
| Q |
29 |
cctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagt |
126 |
Q |
| |
|
|||| |||||||||||||||||||| || |||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||| |||| |
|
|
| T |
23796507 |
cctggaaacagcctcttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgctggagctttagt |
23796606 |
T |
 |
| Q |
127 |
gcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
23796607 |
gcaccgggctgcccttt |
23796623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 8197066 - 8197201
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||| || ||||||||| |||||| ||||||||||||| |||||||||| ||||||||| |
|
|
| T |
8197066 |
aaaggtcacgggttcaagtcctggtaattgcctcttgtgtaaaaaacatggtaaggctacgtacagtacaccaaatggtaggaccccttctcggaccctg |
8197165 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| |||| |||||| ||||| ||||||||||||||| |
|
|
| T |
8197166 |
cgtatgttggagctttagtgtaccgggttgcccttt |
8197201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 10 - 133
Target Start/End: Complemental strand, 2435922 - 2435796
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||| |||| |||||||| |||||||||||||||| ||||||||||||||||| ||| ||||| |
|
|
| T |
2435922 |
aaaggtcacgggttcaagtcctggaaacagcctcctgtgtgaaaaatagggtaagcctgcgtacaatacaccaaaatggtgggacccctttccgtaccct |
2435823 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgg |
133 |
Q |
| |
|
| ||||||||||| ||||||||||| |
|
|
| T |
2435822 |
ccgcatgcgggagctttagtgcaccgg |
2435796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 14 - 131
Target Start/End: Original strand, 19701597 - 19701717
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacag--ggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcat |
110 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||| | ||||||| || ||||||||||||||| ||||||| |||||||||||||||||| | |
|
|
| T |
19701597 |
gtcacgggtttaagtcatgaaaacagcctcttgtgtaaaaaacttggtaaggatgggtacaatacaccaaaatggtggggccccttcccggaccctgcgt |
19701696 |
T |
 |
| Q |
111 |
atgcgggagctctagtgcacc |
131 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
19701697 |
atgcgggagctttagtgcacc |
19701717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 9939484 - 9939622
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa--aacagggtaaggctgcgtacaatacaccaaa--tggtgggacccc-ttcccggacc |
104 |
Q |
| |
|
|||||||||| |||||||||||| ||||| |||||||| ||| |||| ||||||| ||||| |||||||||||| |||||||||||| ||| |||||| |
|
|
| T |
9939484 |
aaaggtcacgagttcaagtcctggaaacaacctcttgtttaagaaacatggtaaggttgcgtgcaatacaccaaaaatggtgggacccccttctcggacc |
9939583 |
T |
 |
| Q |
105 |
ctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||| |||||||||||| |||||||||||||| |||||| |
|
|
| T |
9939584 |
ctgcgtatgcgggagctttagtgcaccgggttacccttt |
9939622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 50 - 143
Target Start/End: Complemental strand, 18742052 - 18741957
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |||||| ||||| |||||||||||||| |||||| |
|
|
| T |
18742052 |
aaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttcccttt |
18741957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 10 - 134
Target Start/End: Complemental strand, 44485244 - 44485119
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||||||||||| ||||||| ||||| || ||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
44485244 |
aaaggtcacgggttatagtcctggaaacaaccacttgtgtaaaagacatggtaaggctgcgtacaatacaccaaatggttggaccccttcccggatccta |
44485145 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccggg |
134 |
Q |
| |
|
| |||||||||||| | |||||||||| |
|
|
| T |
44485144 |
cgtatgcgggagct-ttgtgcaccggg |
44485119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 50 - 143
Target Start/End: Complemental strand, 1517404 - 1517311
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||| | ||||||||||||||||||||||| ||||||||||||||| | |||||||| ||||| |||||| ||||||||||||||||||||| |
|
|
| T |
1517404 |
aaaacatgataaggctgcgtacaatacaccaattggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgcccttt |
1517311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 10 - 131
Target Start/End: Complemental strand, 45264535 - 45264411
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||| |||| ||| ||||||||| || |||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
45264535 |
aaaggtcacatgttcaagtcctggaaacaacctcttgtgcaaaaaacagagtaaggctgtgtgcaatacaccaaaatggtgggaccccttctcagaccct |
45264436 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
||||||||||||||| ||||||||| |
|
|
| T |
45264435 |
gcatatgcgggagctttagtgcacc |
45264411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 50 - 143
Target Start/End: Complemental strand, 42304302 - 42304207
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||| |||| ||||||| ||||||||||| ||||||||| |
|
|
| T |
42304302 |
aaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgcccttt |
42304207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 51 - 143
Target Start/End: Original strand, 43768205 - 43768297
Alignment:
| Q |
51 |
aaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||| |||||||| ||| |||||||| || ||||||||| |||||||| |
|
|
| T |
43768205 |
aaacagggtaaggctgcctacaatacaccaattggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgcccttt |
43768297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 10 - 108
Target Start/End: Complemental strand, 22930202 - 22930104
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||| |||||||||| |||||||||| || | ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22930202 |
aaaggtcatgggttcaagtcctggaaacagccttttgtgtaaaaacagggtaaggttgtg-acaatacaccaaatggtgggaccccttcctggaccctgc |
22930104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 80 - 143
Target Start/End: Original strand, 50606498 - 50606561
Alignment:
| Q |
80 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50606498 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
50606561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 10 - 119
Target Start/End: Original strand, 20036243 - 20036355
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa---acagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||| | |||||||| ||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20036243 |
aaaggtcacgggttcaagtcctggaaacaaactcttgtgtaaagagaaagggtaagattgcgttcaatacaccaaatggtggaaccccttcccggaccct |
20036342 |
T |
 |
| Q |
107 |
gcatatgcgggag |
119 |
Q |
| |
|
|| ||||| |||| |
|
|
| T |
20036343 |
gcgtatgcaggag |
20036355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 19 - 141
Target Start/End: Original strand, 22324925 - 22325049
Alignment:
| Q |
19 |
gggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcg |
115 |
Q |
| |
|
||||||||||| || |||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||| |||| |||| |||||||| |||||| |
|
|
| T |
22324925 |
gggttcaagtcttggaaacagcctcttgtgtaaaaacagggtaaggctgcatacaatacaccaaaaatggtggagccccgtccc-gaccctgcgtatgcg |
22325023 |
T |
 |
| Q |
116 |
ggagctctagtgcaccgggttgccct |
141 |
Q |
| |
|
|||||| ||||||||| || |||||| |
|
|
| T |
22325024 |
ggagctttagtgcaccaggctgccct |
22325049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 53 - 121
Target Start/End: Original strand, 15505632 - 15505700
Alignment:
| Q |
53 |
acagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
121 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
15505632 |
acagggtaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagct |
15505700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 29 - 134
Target Start/End: Complemental strand, 34149076 - 34148969
Alignment:
| Q |
29 |
cctgaaaacagcctcttgtgta--aaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagt |
126 |
Q |
| |
|
|||| ||||||||||||||||| ||| ||||||||| ||||||||| | ||||||||||| |||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
34149076 |
cctggaaacagcctcttgtgtagaaaatagggtaaggttgcgtacaaaagaccaaatggtgagaccccttcctggaccctgcatatgcaggagcgctagt |
34148977 |
T |
 |
| Q |
127 |
gcaccggg |
134 |
Q |
| |
|
||| |||| |
|
|
| T |
34148976 |
gcaacggg |
34148969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 10 - 139
Target Start/End: Original strand, 35019253 - 35019383
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||| | ||||||||||| ||||| |||||||| ||||| ||| ||||||||| ||||||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
35019253 |
aaaggtcacagattcaagtcctgtaaacaacctcttgtataaaaatcagtataaggctgcatacaatacaccaattggtgggacccc-tcccagaccctg |
35019351 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
| |||||| ||||| |||||||||||| |||| |
|
|
| T |
35019352 |
cgtatgcgagagctttagtgcaccgggctgcc |
35019383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 25 - 141
Target Start/End: Complemental strand, 15511271 - 15511150
Alignment:
| Q |
25 |
aagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcg--tacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggag |
119 |
Q |
| |
|
|||||||| |||| ||||||||||||||| ||||||||||||||| |||||||||||||| |||||| ||||||||| ||||||||| |||| | ||| |
|
|
| T |
15511271 |
aagtcctggaaaccgcctcttgtgtaaaaaacagggtaaggctgcggatacaatacaccaaaatggtggtaccccttcctggaccctgcgtatgtgtgag |
15511172 |
T |
 |
| Q |
120 |
ctctagtgcaccgggttgccct |
141 |
Q |
| |
|
|| |||||||||||| |||||| |
|
|
| T |
15511171 |
ctttagtgcaccgggctgccct |
15511150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 50811962 - 50812098
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||| ||| |||||| ||||||| |||||||||||| |||||||||| ||||||||||||||| ||||||| ||||||||||||| ||| |
|
|
| T |
50811962 |
aaaggtcacggaatcatgtcctggaaacagcttcttgtgtaaaaaaacagggtaaggttgcgtacaatacaccaaaatggt-ggaccccttcccgcgccc |
50812060 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| |||||||||||| || ||||| ||| |||||||| |
|
|
| T |
50812061 |
tgcgtatgcgggagctttaatgcactgggctgcccttt |
50812098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 50 - 141
Target Start/End: Complemental strand, 19932848 - 19932755
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| || | ||||||||| ||||||||| |
|
|
| T |
19932848 |
aaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcaccaggttgccct |
19932755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 50 - 143
Target Start/End: Complemental strand, 20999943 - 20999850
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||| |||| |||||||| | ||||||| || ||||||||| |||||||||||| |||||||| |
|
|
| T |
20999943 |
aaaacaaggcaaggctgcgtacaatacaccaaatgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgggctgcccttt |
20999850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 10 - 134
Target Start/End: Original strand, 23371147 - 23371271
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca-gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||| |||||| | ||| |||| || ||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
23371147 |
aaaggtcacgggttcaagtcctagaaacagccacttgggtaaaaaacgggcaaggttgtgtacaatacaccaaatgctgggacccctt-ccagaccctgc |
23371245 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccggg |
134 |
Q |
| |
|
|||| || |||| |||||||||||| |
|
|
| T |
23371246 |
gtatgtggtagctttagtgcaccggg |
23371271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 121
Target Start/End: Original strand, 30682845 - 30682948
Alignment:
| Q |
18 |
cgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgg |
116 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||| || |||||| || ||||| |||| |||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
30682845 |
cgggttcaaatcctgaaaatagcctcttgtgtaaaaacaaggtaagattgtgtaca-tacaacaaatggtgggaccccttcccggaccgtgcgtatgcgg |
30682943 |
T |
 |
| Q |
117 |
gagct |
121 |
Q |
| |
|
||||| |
|
|
| T |
30682944 |
gagct |
30682948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 12 - 81
Target Start/End: Complemental strand, 50760359 - 50760288
Alignment:
| Q |
12 |
aggtcacgggttcaagtcctgaaaacagcctcttgtg--taaaacagggtaaggctgcgtacaatacaccaa |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||| |
|
|
| T |
50760359 |
aggtcacgggttcaagtcctgaaaacagcctcttgtgtataaaactgggtaaggctgcgtataatacaccaa |
50760288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 19974209 - 19974074
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||| |||||||| |||| |||| |||||||||||||||||| || |||||||| ||||||||| || |
|
|
| T |
19974209 |
aaagatcacgggttcaagtcttggaaacagcctcaagtgtaaaaatagggcaaggttgcgtacaatacaccaaaatgatgggacccattcccggactcta |
19974110 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||| |
|
|
| T |
19974109 |
tgtatgcgggagctttagtgcacggggctgcccttt |
19974074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 31272509 - 31272381
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||| ||||||||||||| ||||| |||||||||| |||||| |||||||||||||||| ||| ||||||||||| | ||||||||||| |
|
|
| T |
31272509 |
aaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaacatggtaaggctgcgtacagcacatcaaatggtggg------ttccggaccctgc |
31272416 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||| || ||| |||||||| |
|
|
| T |
31272415 |
gtatgcgggagctttagtggactgggctgcccttt |
31272381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 50 - 136
Target Start/End: Complemental strand, 31442483 - 31442396
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggtt |
136 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||||| ||| |||| ||||||| | |||||||||||| |
|
|
| T |
31442483 |
aaaacagggtaaggatgcgtacaatacaccaaaatggtgggaccccttcccggacactgtgtatgtgggagctttggtgcaccgggtt |
31442396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 76 - 138
Target Start/End: Complemental strand, 4587630 - 4587568
Alignment:
| Q |
76 |
caccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgc |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
4587630 |
caccaaatggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttgc |
4587568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 11 - 89
Target Start/End: Complemental strand, 4430160 - 4430080
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtggg |
89 |
Q |
| |
|
||||||||||||| ||||| ||||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4430160 |
aaggtcacgggtttaagtcttgaaaacagtatcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtggg |
4430080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 13 - 98
Target Start/End: Complemental strand, 17470478 - 17470390
Alignment:
| Q |
13 |
ggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcc |
98 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||| |||| |
|
|
| T |
17470478 |
ggtcatgggttcaagtcctagaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatagtgggacccgttcc |
17470390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 27 - 121
Target Start/End: Complemental strand, 20169207 - 20169111
Alignment:
| Q |
27 |
gtcctgaaaacagcctcttgtgtaaaacag--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
121 |
Q |
| |
|
|||||||||||| |||||||||||||| | |||||| ||| ||||||||| |||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20169207 |
gtcctgaaaacaccctcttgtgtaaaaaaaaaggtaagactgtgtacaataccccaatcggtgggactccttcccggaccctgcatatgcgggagct |
20169111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 8 - 140
Target Start/End: Complemental strand, 39215096 - 39214961
Alignment:
| Q |
8 |
taaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggacc |
104 |
Q |
| |
|
||||||||| | |||||||| ||| ||||| |||||||||||||| | |||||||||||||||||||| ||||| ||||||| ||||||||| ||| |
|
|
| T |
39215096 |
taaaaggtcccaagttcaagtactggaaacaacctcttgtgtaaaaaactgggtaaggctgcgtacaatattccaaaatggtgggtccccttcccaaacc |
39214997 |
T |
 |
| Q |
105 |
ctgcatatgcgggagctctagtgcaccgggttgccc |
140 |
Q |
| |
|
|||| |||| || |||| |||||||||||| ||||| |
|
|
| T |
39214996 |
ctgcgtatgtggaagctttagtgcaccgggctgccc |
39214961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 10 - 146
Target Start/End: Original strand, 33223007 - 33223152
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacacc-aaatggtg-------ggaccccttcccg |
100 |
Q |
| |
|
||||||||||| || ||||| || |||||||||||||||| ||||||||| |||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
33223007 |
aaaggtcacggatttaagtcatggaaacagcctcttgtgtaaaaacagggaaaggttgcgtacaatacaccaaaatggtgggaccccggaccccttcccg |
33223106 |
T |
 |
| Q |
101 |
gaccctgcatatgcgggagctctagtgcaccgggttgccctttaat |
146 |
Q |
| |
|
||| |||| |||| | |||||||||||||| | ||| |||||||| |
|
|
| T |
33223107 |
gactctgcctatgtagaagctctagtgcaccagattgtcctttaat |
33223152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 11 - 133
Target Start/End: Complemental strand, 27136786 - 27136661
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||| |||| |||||||| ||| |||| |||||||||||||| || ||||||| ||||||||||||||| ||||||||||||||||||| || | || |
|
|
| T |
27136786 |
aaggacacgagttcaagttctgggaacaacctcttgtgtaaaaaacatggtaaggttgcgtacaatacaccaaaatggtgggaccccttcctagatcatg |
27136687 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgg |
133 |
Q |
| |
|
||||||||||||| |||||||||| |
|
|
| T |
27136686 |
tgtatgcgggagctccagtgcaccgg |
27136661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 50 - 106
Target Start/End: Complemental strand, 21910742 - 21910686
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21910742 |
aaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccct |
21910686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 34 - 143
Target Start/End: Complemental strand, 19656217 - 19656105
Alignment:
| Q |
34 |
aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
130 |
Q |
| |
|
|||||||||||||||||||| || ||||| ||| ||||||||||||||| |||| |||||| ||| ||||||||||||||| ||||| || ||||| |
|
|
| T |
19656217 |
aaacagcctcttgtgtaaaaaacatggtaacgctatgtacaatacaccaaaatggtaggaccctttcttggaccctgcatatgcaagagctttaatgcac |
19656118 |
T |
 |
| Q |
131 |
cgggttgcccttt |
143 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
19656117 |
cgggctgcccttt |
19656105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 34 - 113
Target Start/End: Original strand, 21723731 - 21723811
Alignment:
| Q |
34 |
aaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatg |
113 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||| ||||||||||||||||||| | ||| |||||||||||||| |||| |
|
|
| T |
21723731 |
aaacagcctcttgtataaaaatagggtaaggctgagtacaatacaccaaatggtagaaccttttcccggaccctgcgtatg |
21723811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 139
Target Start/End: Original strand, 22327122 - 22327250
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||| ||||||||||||||| ||||| |||||||||| ||||||||||||||||| |||| || |||| |||||||||| |||||| || || |
|
|
| T |
22327122 |
aaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacgatgcaccaaaatggtggg----gttcccgaactct |
22327217 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
| |||||||||||| | |||||||||| |||| |
|
|
| T |
22327218 |
gtgtatgcgggagctttggtgcaccgggctgcc |
22327250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 80 - 143
Target Start/End: Original strand, 30555210 - 30555273
Alignment:
| Q |
80 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||| ||||| |||||||||||| || ||||| |
|
|
| T |
30555210 |
aaatggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccgggctgaccttt |
30555273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 62 - 128
Target Start/End: Complemental strand, 4430080 - 4430014
Alignment:
| Q |
62 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc |
128 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| | ||| |||| |||||||||||| |||||| |
|
|
| T |
4430080 |
ggctgcgtacaatacaccaaatggtggaacccctttctggatcctgtgtatgcgggagctttagtgc |
4430014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 54 - 127
Target Start/End: Original strand, 6358190 - 6358264
Alignment:
| Q |
54 |
cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
127 |
Q |
| |
|
|||||||| ||||||||||| |||||||| ||||||||||||||||| |||||||| ||||| ||| || ||||| |
|
|
| T |
6358190 |
cagggtaaagctgcgtacaaaacaccaaaatggtgggaccccttcccagaccctgcgtatgcaggatctttagtg |
6358264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 93 - 143
Target Start/End: Complemental strand, 19386626 - 19386576
Alignment:
| Q |
93 |
ccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||| |||| |
|
|
| T |
19386626 |
ccttcccggaccctgcatatgcgggagctctagtgaaccaggttgctcttt |
19386576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 50 - 120
Target Start/End: Complemental strand, 20982843 - 20982773
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagc |
120 |
Q |
| |
|
|||| ||||||||||||| |||||||||| |||||||||| | |||| |||||||||| ||||||||||| |
|
|
| T |
20982843 |
aaaatagggtaaggctgccaacaatacacctaatggtgggatctcttctcggaccctgcgtatgcgggagc |
20982773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 66 - 131
Target Start/End: Complemental strand, 4249520 - 4249455
Alignment:
| Q |
66 |
gcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||| || |||||||||||| || |||||| |
|
|
| T |
4249520 |
gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc |
4249455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 66 - 131
Target Start/End: Complemental strand, 4249844 - 4249779
Alignment:
| Q |
66 |
gcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||| || |||||||||||| || |||||| |
|
|
| T |
4249844 |
gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc |
4249779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 66 - 131
Target Start/End: Complemental strand, 4250168 - 4250103
Alignment:
| Q |
66 |
gcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||| || |||||||||||| || |||||| |
|
|
| T |
4250168 |
gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc |
4250103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 59 - 140
Target Start/End: Complemental strand, 28894642 - 28894561
Alignment:
| Q |
59 |
taaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
140 |
Q |
| |
|
||||| ||||||||||||| |||||||| ||||||||| ||||||||||||||| ||||| ||||||||| || ||||| |
|
|
| T |
28894642 |
taaggttgcgtacaatacatcaaatggtaaaaccccttcctagaccctgcatatgcgagagctttagtgcaccaggctgccc |
28894561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 78 - 143
Target Start/End: Complemental strand, 33594196 - 33594131
Alignment:
| Q |
78 |
ccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||| ||||||||||||||||| |||||||| |||||||||||| |||||||| ||| | |||||| |
|
|
| T |
33594196 |
ccaattggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcactgggctacccttt |
33594131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 22 - 143
Target Start/End: Original strand, 24564379 - 24564492
Alignment:
| Q |
22 |
ttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
119 |
Q |
| |
|
|||||||| || ||||| |||||||||||||| |||||||||| |||||||||| ||||||||||| ||| ||||||||| ||||| |||| |
|
|
| T |
24564379 |
ttcaagtcttggaaacaacctcttgtgtaaaaaacagggtaagggtgcgtacaattcaccaaatggt-------ctt---ggaccctgcctatgcaggag |
24564468 |
T |
 |
| Q |
120 |
ctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| ||||||||||||||||||||| |
|
|
| T |
24564469 |
cgttagtgcaccgggttgcccttt |
24564492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 131
Target Start/End: Original strand, 7074588 - 7074663
Alignment:
| Q |
57 |
ggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
|||| ||||||||||||||||||||| | |||||||| ||| | |||||||||||| |||||||| ||||||||| |
|
|
| T |
7074588 |
ggtatggctgcgtacaatacaccaaaattgtgggacctctttctagaccctgcatatccgggagctttagtgcacc |
7074663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 88 - 143
Target Start/End: Original strand, 16120819 - 16120874
Alignment:
| Q |
88 |
ggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| || |||||| || |||||||| |
|
|
| T |
16120819 |
ggaccccttcccggcccctgcatatgcgggagctttaatgcaccaggctgcccttt |
16120874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 15 - 129
Target Start/End: Original strand, 43207523 - 43207640
Alignment:
| Q |
15 |
tcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcata |
111 |
Q |
| |
|
|||| |||| ||||| || ||||| |||||| ||| ||||||||||||| | || |||||||||||||| |||||||||| |||||| |||||| || |
|
|
| T |
43207523 |
tcacaggtttaagtcttggaaacaacctcttatgtgaaaaacagggtaagacggcatacaatacaccaaattggtgggacctcttcccagaccctatgta |
43207622 |
T |
 |
| Q |
112 |
tgcgggagctctagtgca |
129 |
Q |
| |
|
|||| ||||| ||||||| |
|
|
| T |
43207623 |
tgcgagagctttagtgca |
43207640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 28 - 74
Target Start/End: Complemental strand, 44745900 - 44745854
Alignment:
| Q |
28 |
tcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaat |
74 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
44745900 |
tcctggaaacagcctcttgtgtaaaacaaggtaaagctgcgtacaat |
44745854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 34 - 141
Target Start/End: Complemental strand, 34679330 - 34679217
Alignment:
| Q |
34 |
aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggac----cctgcatatgcgggagctctagtg |
127 |
Q |
| |
|
||||| |||||||||||||| ||||||||| |||||||| ||||| |||||||||| |||| | || ||| ||||| |||||||||||| |||| |
|
|
| T |
34679330 |
aaacaacctcttgtgtaaaaaacagggtaagactgcgtactatacatcaaatggtggagccccgttccagacccggcctgcgtatgcgggagctttagta |
34679231 |
T |
 |
| Q |
128 |
caccgggttgccct |
141 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
34679230 |
caccgggctgccct |
34679217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 2436028 - 2435985
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa |
53 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||| ||||||||| |
|
|
| T |
2436028 |
aaaggtcacgggttcaagtcctggaaacaacctcctgtgtaaaa |
2435985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 18335423 - 18335333
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaac--agggtaaggctgcgtacaatacaccaaatggtgggaccccttcc |
98 |
Q |
| |
|
||||||||| ||| |||||||| |||||| ||||||| ||||| ||||||| | ||||||||||||| |||||| |||||||| |||| |
|
|
| T |
18335423 |
aaaggtcacaagttaaagtcctggaaacagtctcttgtttaaaaattagggtaaagttgcgtacaatacatcaaatgatgggaccctttcc |
18335333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 141
Target Start/End: Original strand, 42432228 - 42432267
Alignment:
| Q |
102 |
accctgcatatgcgggagctctagtgcaccgggttgccct |
141 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
42432228 |
accctgcatatgctggagctctagtgcaccggattgccct |
42432267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 69 - 129
Target Start/End: Complemental strand, 43921866 - 43921804
Alignment:
| Q |
69 |
tacaatacaccaaatggtgggacccc--ttcccggaccctgcatatgcgggagctctagtgca |
129 |
Q |
| |
|
|||||||||||||||||| ||||||| ||| ||||||||||| ||||| ||||| ||||||| |
|
|
| T |
43921866 |
tacaatacaccaaatggtaggacccctattctcggaccctgcacatgcgagagctttagtgca |
43921804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 143
Target Start/End: Original strand, 5549582 - 5549677
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacacc---aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| |||||| |||||||||| ||||| ||||||||||| | |||| |||| ||||| |||||| |||| || | ||||||||||| |
|
|
| T |
5549582 |
aaaacagggtaaagctgcgcacaatacaccaaaaaatgatgggacccctttctggactctgcctatgcaggagctttagtaca-caggttgcccttt |
5549677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 143
Target Start/End: Complemental strand, 25554796 - 25554742
Alignment:
| Q |
89 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| ||||||||||| |||||||| |
|
|
| T |
25554796 |
gaccccttcccgaaccctgcgtatgcgggagcattagtgcaccggactgcccttt |
25554742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 91
Target Start/End: Original strand, 46859131 - 46859173
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacacc-aaatggtgggac |
91 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
46859131 |
aaaacagggtaagactgcgtacaatacaccaaaatggtgggac |
46859173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 52 - 96
Target Start/End: Original strand, 10158266 - 10158310
Alignment:
| Q |
52 |
aacagggtaaggctgcgtacaatacaccaaatggtgggacccctt |
96 |
Q |
| |
|
||||| |||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
10158266 |
aacagagtaatgctacgtacaatacaccaaatggtggcacccctt |
10158310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 30579 - 30712
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30579 |
aaaggtcaccggttcaagtcctggaaacagcctcttgtgtaaaacagggtagggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
30678 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30679 |
tatgcgggagctctagtgcaccgggttgcccttt |
30712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 76)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 21779394 - 21779261
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21779394 |
aaaggtcacgggttcaagtcctggagacagcctcttgtgtaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
21779295 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21779294 |
tatgcgggagctctagtgcaccgggttgcccttt |
21779261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 14 - 143
Target Start/End: Original strand, 9671185 - 9671314
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatg |
113 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9671185 |
gtcacgggttcaaatcctggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatg |
9671284 |
T |
 |
| Q |
114 |
cgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |
|
|
| T |
9671285 |
cgggagctttagtgcaccgggttgcccttt |
9671314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 10 - 144
Target Start/End: Original strand, 23397766 - 23397900
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
23397766 |
aaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaatagggtaaggctacgtacaatacaccaaatggtgggaccccttctcggaccctaca |
23397865 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
23397866 |
tatgcgggagctctagtgcaccgggttgcccttta |
23397900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 8455450 - 8455316
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8455450 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
8455351 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||| |
|
|
| T |
8455350 |
gtatgccggagctttagtgcaccgggttgcccttt |
8455316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 10546162 - 10546298
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10546162 |
aaaggtcacgggttcaagtcctggaaacatcctcttgtataaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
10546261 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
10546262 |
gcgtatgcgggagctttagtgcaccgggttgcccttt |
10546298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 14444730 - 14444863
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14444730 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgtgtacgatacaccaaatggtgggaccccttcccggaccctgcg |
14444829 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| |
|
|
| T |
14444830 |
tatgcgggagctttagtgcaccaggttgcccttt |
14444863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 10543698 - 10543835
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10543698 |
aaaggtcacgggttcaagtcctggaaacggcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccc |
10543797 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
10543798 |
tgcgtatgcgggagctttagtgcaccgggttgcccttt |
10543835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 10 - 144
Target Start/End: Original strand, 14530318 - 14530456
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14530318 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctacgtacaatacaccaataatggtgggaccccttcccggaccc |
14530417 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
14530418 |
tgcgtatgcgggagctttagtgcaccgggttgcccttta |
14530456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 25249871 - 25249738
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgta-aaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||| || |||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
25249871 |
aaggtcacgggttcaagtcatggaaacagtctcttgtgtacaaacagggtaaggctgcgtacaatacaccaaatggtgggatcccttcccgaaccctgcg |
25249772 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||| |
|
|
| T |
25249771 |
tatgcgtgagctttagtgcaccgggttgcccttt |
25249738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 26 - 143
Target Start/End: Original strand, 36871509 - 36871626
Alignment:
| Q |
26 |
agtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctcta |
124 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| || |
|
|
| T |
36871509 |
agtcctggaaacagcctcttgtgtgaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-cctgcgtatgcgggagcttta |
36871607 |
T |
 |
| Q |
125 |
gtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36871608 |
gtgcaccgggttgcccttt |
36871626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 10 - 133
Target Start/End: Complemental strand, 12024053 - 12023929
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12024053 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccctcccggaccctgc |
12023954 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgg |
133 |
Q |
| |
|
||| || |||| || |||||||| |
|
|
| T |
12023953 |
gtatttggaagctttaatgcaccgg |
12023929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 11514437 - 11514570
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
11514437 |
aaggtcacgggttcaactcctggaaacagcctcttgtgtaaaaaacaaagtaaggctgcgtacaatacaccaaatggtggga-cccttcccagaccctgc |
11514535 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| |
|
|
| T |
11514536 |
gtatgcgggagctttagtgcaccggattgcccttt |
11514570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 17668003 - 17668137
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||||| ||| | |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| || ||||||| |
|
|
| T |
17668003 |
aaggtcacgggttcaagtcctggaaagaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacaccaaatggtggaaccccttctcgaaccctgc |
17668102 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| ||||||| ||||||||||||||||||||| |
|
|
| T |
17668103 |
gtatatgggagctttagtgcaccgggttgcccttt |
17668137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 14 - 143
Target Start/End: Complemental strand, 24200756 - 24200623
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
24200756 |
gtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaacccttcccggaccctgag |
24200657 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||| | ||||| ||||||||||||||||||||| |
|
|
| T |
24200656 |
tatgtgagagctttagtgcaccgggttgcccttt |
24200623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 17623565 - 17623699
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| | ||||| |
|
|
| T |
17623565 |
aaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaatcctgc |
17623664 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||| || |||| |||||||| |||||||||||| |
|
|
| T |
17623665 |
gtatgtggaagctttagtgcactgggttgcccttt |
17623699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 5841029 - 5841165
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||| | |||||||| ||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
5841029 |
aaggtcacgggttcaagtcctagaaacagccttttgtgtaaaaaatagggtaaggatgcgtacaatacatcaataatggtgggaccccttcccggacccc |
5841128 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
5841129 |
gcatatgcgggagctttagtgcaccgagttgcccttt |
5841165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 25079852 - 25079717
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||||| | ||||| |||||||||||||| || ||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25079852 |
aaggtcacgggttcaagtcttagaaacaacctcttgtgtaaaaaaacaaggtaaggatgcgtacaatacaccgaatggtgggaccccttcccggaccctg |
25079753 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| ||||| ||||| ||||||||||||||||||||| |
|
|
| T |
25079752 |
cgtatgcaagagctttagtgcaccgggttgcccttt |
25079717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 12 - 107
Target Start/End: Original strand, 22371059 - 22371153
Alignment:
| Q |
12 |
aggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22371059 |
aggtcacgggttcaagtcctggaaacagcctcgtgta-aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
22371153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 17896259 - 17896395
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca---gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||||| |||||||||| ||||| |||||||||||||| | |||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
17896259 |
aaaggtcacggattcaagtcctagaaacaacctcttgtgtaaaaaaatagggtaaggctgcgtacaatataccaaatggtgggaccccttctcggaccct |
17896358 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|| |||| ||||||| ||||||| || |||||||||| |
|
|
| T |
17896359 |
gcgtatgtgggagctttagtgcatcgagttgcccttt |
17896395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 34 - 143
Target Start/End: Complemental strand, 40762345 - 40762234
Alignment:
| Q |
34 |
aaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| ||||||||||||||||||||||||||| |||| ||||||||| |||| ||||||| ||||||||| |
|
|
| T |
40762345 |
aaacagcctcttgtgtaaaaaactgggtaaggctacgtacaatacaccaaatggtgggaccctttcctggaccctgcgtatgtgggagctttagtgcacc |
40762246 |
T |
 |
| Q |
132 |
gggttgcccttt |
143 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40762245 |
gggttgcccttt |
40762234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 25641502 - 25641636
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||||||||||||| ||||||| | |||||| |||||||||||| | ||||||||||||||||||| |||||||||||||||| | ||||| |
|
|
| T |
25641502 |
aaaggtcacgggttcaagtcctggaaacagcattttgtgtgaaaacagggtaaagttgcgtacaatacaccaaattgtgggaccccttcccgaatcctgc |
25641601 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||| ||||| ||||| ||||| ||| ||||| |
|
|
| T |
25641602 |
gtatgcgagagctttagtgaaccggattgtccttt |
25641636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 10 - 127
Target Start/End: Complemental strand, 99398 - 99281
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||| || ||||||||||||||||||||||||||||| |||||||| | ||||||| |
|
|
| T |
99398 |
aaaggtcacgggttcaagtcctagaaacagcctcttgtaaaaaacatggcaaggctgcgtacaatacaccaaatggtggaaccccttctcagaccctgtg |
99299 |
T |
 |
| Q |
110 |
tatgcgggagctctagtg |
127 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
99298 |
tatgcgggagctttagtg |
99281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 39914440 - 39914306
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||| |||||| ||| ||||| |||||||||||||| |||||||||| || |||||||||||| |||||||||||||||| || ||||||| |
|
|
| T |
39914440 |
aaggtcacgggatcaagtactggaaacaacctcttgtgtaaaaaaacagggtaaggatgtgtacaatacaccgaatggtgggacccctt-cctgaccctg |
39914342 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| |||||||||||| ||||||| ||||||||||||| |
|
|
| T |
39914341 |
cgtatgcgggagctttagtgcatcgggttgcccttt |
39914306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 11 - 144
Target Start/End: Complemental strand, 40417005 - 40416870
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||||||||| || ||||| |||||||| ||||| ||||| ||||||| |||||||||||||| || |||||||| || ||||||||| |
|
|
| T |
40417005 |
aaggtcacgggttcaagtcatggaaacaacctcttgtataaaaaacagggaaaggctgtgtacaatacaccaattgatgggacccttttttggaccctgc |
40416906 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
40416905 |
atatgcgagagctttagtgcaccgggttgcccttta |
40416870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 11 - 147
Target Start/End: Complemental strand, 13245220 - 13245091
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcat |
110 |
Q |
| |
|
||||||||| |||||||||||| ||||| |||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
13245220 |
aaggtcacgagttcaagtcctggaaacaacctcttgtgt-------ggtaaggctgcgtacattacactaaatggtgggaccccttcccggaccatgcat |
13245128 |
T |
 |
| Q |
111 |
atgcgggagctctagtgcaccgggttgccctttaatg |
147 |
Q |
| |
|
|| |||||||| ||||| | |||||||||||| |||| |
|
|
| T |
13245127 |
atacgggagctttagtgtatcgggttgcccttgaatg |
13245091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 10 - 105
Target Start/End: Complemental strand, 23145833 - 23145736
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||| ||| |||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
23145833 |
aaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaattggtgggaccctttcccggaccc |
23145736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 10 - 105
Target Start/End: Complemental strand, 23557623 - 23557526
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||| ||| |||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
23557623 |
aaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaattggtgggaccctttcccggaccc |
23557526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 10 - 121
Target Start/End: Complemental strand, 32781423 - 32781310
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||||||| ||||||||| | ||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32781423 |
aaaggtcacgagttcaagtctcggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccagaccctg |
32781324 |
T |
 |
| Q |
108 |
catatgcgggagct |
121 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32781323 |
tgtatgcgggagct |
32781310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 131
Target Start/End: Complemental strand, 19977849 - 19977726
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||| ||||||| | || ||||| |||||||||||||||||||||||||| ||||||||| ||| || |
|
|
| T |
19977849 |
aaaggtcacgggttcaagttctggaaacagcctcttttgtaaaaaataggataaggttgcgtacaatacaccaaatggtgggatcccttcccgaaccttg |
19977750 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcacc |
131 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
19977749 |
tgtatgcgggagctttagtgcacc |
19977726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 10 - 144
Target Start/End: Complemental strand, 17380371 - 17380237
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgta-aaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||||| || ||||| ||||||||||| ||||||||||||| || || |||||||||||||| ||| ||||||||| ||||||||| |
|
|
| T |
17380371 |
aaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaacagggtaaggttgtgtgcaatacaccaaatgatggaaccccttcctggaccctgc |
17380272 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||||||||||| | |||||||||| | ||||||| |
|
|
| T |
17380271 |
ggatgcgggagct-ttgtgcaccgggcttcccttta |
17380237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 27573621 - 27573755
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgta-aaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||| ||||||||||| | |||||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||| ||||| |||||| |
|
|
| T |
27573621 |
aaaggtcattggttcaagtccgggcaacagcctcttgtgtataaacatggtaaggctgcgtacaatacaccaaatggtggaaccatttcccaaaccctgt |
27573720 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
27573721 |
gtatgtgggagctttagtgcatcgggttgcccttt |
27573755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 44643522 - 44643658
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||| |||||||| || ||| |||||||| |||||| ||| ||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
44643522 |
aaaggtcacgtgttcaagttctagaaagagcctcttccgtaaaaaaacagagtaaggctgcgtacaatgtaccaaatggtgggaccccttcccagaccct |
44643621 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|| ||||||||||| |||||||||||| |||||||| |
|
|
| T |
44643622 |
gcgtatgcgggagccttagtgcaccgggctgcccttt |
44643658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 34 - 140
Target Start/End: Complemental strand, 4516462 - 4516354
Alignment:
| Q |
34 |
aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
|||||||||||||||||||| ||||| || ||||||||||||||||||| |||||||||||||||||||||||||| |||| || |||| ||||| ||| |
|
|
| T |
4516462 |
aaacagcctcttgtgtaaaaaacagggcaacgctgcgtacaatacaccaattggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtacc |
4516363 |
T |
 |
| Q |
132 |
gggttgccc |
140 |
Q |
| |
|
||| ||||| |
|
|
| T |
4516362 |
gggctgccc |
4516354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 10 - 106
Target Start/End: Original strand, 5450285 - 5450384
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||||||||||| ||||| ||||| |||||||||||||| || |||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
5450285 |
aaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaaacatggtaaggctgcgtacaatacaccaaagggtgggaccccttcctggaccct |
5450384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 11 - 139
Target Start/End: Complemental strand, 24860120 - 24859992
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||| ||||||| ||| |||| ||||| ||||| |||||||| || |||| ||||||||||||||||||||||||| | |||||||| |||||||||| |
|
|
| T |
24860120 |
aaggttacgggtttaagccctggaaacaacctctggtgtaaaaacatggta-ggctgcgtacaatacaccaaatggtagaaccccttctcggaccctgcg |
24860022 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
|||||||||||| ||||||||||| ||||| |
|
|
| T |
24860021 |
tatgcgggagctttagtgcaccggattgcc |
24859992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 50 - 143
Target Start/End: Original strand, 25632551 - 25632644
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |||||||| ||| | | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
25632551 |
aaaacaggataaggctgcgtacaatacaccaaatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgcccttt |
25632644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 21377208 - 21377074
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||| ||| ||||||||| | ||||| |||||||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
21377208 |
aaaggttacgagttcaagtcatagaaacatcctcttgtgtaaaaaacagggtaaggctgggtacaatgcaccaaatggtgggaccccttcccgaaccctg |
21377109 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| |||| ||||||| | |||||||| | |||||||| |
|
|
| T |
21377108 |
cgtatgtgggagct-ttgtgcaccgagctgcccttt |
21377074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 26684757 - 26684620
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacag-cctcttgtgtaaaacag---ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
|||||||| |||| ||||||||||||||| |||||||||||||| | ||||||||||||||||||| || ||||||||||||| ||||||| |||| |
|
|
| T |
26684757 |
aaaggtcaaaggtttaagtcctgaaaacagacctcttgtgtaaaaaaatatggtaaggctgcgtacaatatactaaatggtgggacctcttcccgaaccc |
26684658 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||| |||||||||||| || |||||||| ||| ||||| |
|
|
| T |
26684657 |
tgcgtatgcgggagctttaatgcaccggattgtccttt |
26684620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 25 - 131
Target Start/End: Original strand, 30826052 - 30826158
Alignment:
| Q |
25 |
aagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctct |
123 |
Q |
| |
|
||||| || |||||||||||||||||||| ||||||||| |||||||||||||||||||||| ||| |||||||| |||||| |||||||||||||| | |
|
|
| T |
30826052 |
aagtcttggaaacagcctcttgtgtaaaaatagggtaaggttgcgtacaatacaccaaatggt-ggaacccttcccagaccctacatatgcgggagcttt |
30826150 |
T |
 |
| Q |
124 |
agtgcacc |
131 |
Q |
| |
|
|||||||| |
|
|
| T |
30826151 |
agtgcacc |
30826158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 50 - 130
Target Start/End: Original strand, 24890453 - 24890533
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
130 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
24890453 |
aaaacaaggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac |
24890533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 10 - 139
Target Start/End: Original strand, 7214534 - 7214667
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgtacaatacac--caaatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
|||||||| ||||||||||| || |||||| |||||||||||| |||||||||||||||||||||||||| |||||||| || |||||| ||||| | |
|
|
| T |
7214534 |
aaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaatacagggtaaggctgcgtacaatacacaaaaaatggtgagatcccttctcggacac |
7214633 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
||| |||||| ||| | ||||||||| ||||||| |
|
|
| T |
7214634 |
tgcgtatgcgagagttttagtgcaccaggttgcc |
7214667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 10 - 121
Target Start/End: Original strand, 33795285 - 33795398
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtac-aatacaccaaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
||||||||||||||||||||| | ||||| ||||||| || |||||||||||||||||||||| |||||||| |||||||||||||||||| |||||| |
|
|
| T |
33795285 |
aaaggtcacgggttcaagtcccggaaacaacctcttgggtaaaaaacagggtaaggctgcgtacaaatacacc-tatggtgggaccccttcccagaccct |
33795383 |
T |
 |
| Q |
107 |
gcatatgcgggagct |
121 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
33795384 |
gtgtatgcgggagct |
33795398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 83 - 143
Target Start/End: Original strand, 34080176 - 34080236
Alignment:
| Q |
83 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
34080176 |
tggtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgcccttt |
34080236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 10 - 131
Target Start/End: Original strand, 19614992 - 19615116
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccc |
105 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| | ||||||||||||| |||||||||||| |||| ||| || ||||||||||||| |||| |
|
|
| T |
19614992 |
aaaggtcacgggttcaagtccttgaaacatcctcttgtataaaaaacagggtaagactgcgtacaatataccaataatagt-ggaccccttcccgaaccc |
19615090 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
||| ||||| |||||| ||||||||| |
|
|
| T |
19615091 |
tgcgtatgcaggagctttagtgcacc |
19615116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 10 - 131
Target Start/End: Complemental strand, 31158576 - 31158451
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccc |
105 |
Q |
| |
|
|||||||| ||||| ||||| | |||||||||||||| |||||| ||||||||| ||| ||||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
31158576 |
aaaggtcaagggttaaagtcttcaaaacagcctcttgcgtaaaaaacagggtaagattgcatacaataaaccaaaaatggtgggaccccttcccagaccc |
31158477 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
||| |||||||||||| |||| |||| |
|
|
| T |
31158476 |
tgcgtatgcgggagctttagtacacc |
31158451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 82 - 141
Target Start/End: Original strand, 41409936 - 41409995
Alignment:
| Q |
82 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41409936 |
atggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccct |
41409995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 34 - 144
Target Start/End: Original strand, 14544087 - 14544202
Alignment:
| Q |
34 |
aaacagcctcttgtgta---aaacagggtaaggctgcgtacaata--caccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc |
128 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||| ||||| || ||||||| ||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
14544087 |
aaacagcctcttgtgtagaaaaacagggtaagactgcgtgcaataaccaaaaaatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgc |
14544186 |
T |
 |
| Q |
129 |
accgggttgcccttta |
144 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
14544187 |
accaagttgcccttta |
14544202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 10 - 108
Target Start/End: Complemental strand, 44449518 - 44449418
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttg--tgtaaaacagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||||||||| |||||| |||| |||||| ||||||| || |||||||| ||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
44449518 |
aaaggtcacgagttcaa-tcctaaaaacaacctcttgaatgaaaaacaggataaggctgcgtacaatacaccaaaatagtgggaccccttcccggaccct |
44449420 |
T |
 |
| Q |
107 |
gc |
108 |
Q |
| |
|
|| |
|
|
| T |
44449419 |
gc |
44449418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 19 - 143
Target Start/End: Complemental strand, 15296533 - 15296406
Alignment:
| Q |
19 |
gggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcg |
115 |
Q |
| |
|
|||||||||||| | ||||||||| |||||||||| |||||||||||||||||||||| ||| |||| |||||| |||||| |||||||||| |||| | |
|
|
| T |
15296533 |
gggttcaagtcccggaaacagcctgttgtgtaaaatacagggtaaggctgcgtacaatataccaaaatagtgggatcccttctcggaccctgcgtatgtg |
15296434 |
T |
 |
| Q |
116 |
ggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| |||| | |||| || || |||||||| |
|
|
| T |
15296433 |
gaagctttggtgcgccaggctgcccttt |
15296406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 82 - 142
Target Start/End: Complemental strand, 40579810 - 40579750
Alignment:
| Q |
82 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
142 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
40579810 |
atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt |
40579750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 80 - 143
Target Start/End: Original strand, 23488555 - 23488618
Alignment:
| Q |
80 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||| |||| |
|
|
| T |
23488555 |
aaatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgctcttt |
23488618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 77 - 130
Target Start/End: Original strand, 4794871 - 4794924
Alignment:
| Q |
77 |
accaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
130 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4794871 |
accaaatgatgggaccccttcccggatcctgcatatgcgggagctctagtgcac |
4794924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 34 - 133
Target Start/End: Original strand, 17471572 - 17471675
Alignment:
| Q |
34 |
aaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
129 |
Q |
| |
|
|||||||||||||||||||| |||| |||| |||||||||||| |||||| || || ||||||||||| |||||||| |||||||||| | ||||||| |
|
|
| T |
17471572 |
aaacagcctcttgtgtaaaaaaacaggataagactgcgtacaatataccaaaatgatgagaccccttccctgaccctgcctatgcgggagttttagtgca |
17471671 |
T |
 |
| Q |
130 |
ccgg |
133 |
Q |
| |
|
|||| |
|
|
| T |
17471672 |
ccgg |
17471675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 88 - 148
Target Start/End: Original strand, 8575975 - 8576035
Alignment:
| Q |
88 |
ggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttaatgt |
148 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||| ||||||||| |||||||||||||||| |
|
|
| T |
8575975 |
ggaccccttcccggaccctgcgtatgtgggagctttagtgcaccaggttgccctttaatgt |
8576035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 11 - 80
Target Start/End: Original strand, 17705496 - 17705567
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaa--aacagggtaaggctgcgtacaatacacca |
80 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||| ||||| ||||||||| ||||||||||||| |
|
|
| T |
17705496 |
aaggtcacgggttcaagtcctggaaaccgcctcttgtgtaaacaacagagtaaggctgtgtacaatacacca |
17705567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 83 - 143
Target Start/End: Original strand, 34766330 - 34766390
Alignment:
| Q |
83 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||| |||||| |||||| |
|
|
| T |
34766330 |
tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggtttcccttt |
34766390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 92 - 139
Target Start/End: Complemental strand, 39189555 - 39189508
Alignment:
| Q |
92 |
cccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39189555 |
cccttcccggaccccgcatatgcgggagctctagtgcaccgggttgcc |
39189508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 10 - 87
Target Start/End: Complemental strand, 2003672 - 2003592
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtg |
87 |
Q |
| |
|
||||||||||||| ||||||||| |||||||| |||| |||||| |||||||||| ||||||||||||| ||||||||| |
|
|
| T |
2003672 |
aaaggtcacgggtacaagtcctggaaacagccccttgcgtaaaaaaacagggtaaggatgcgtacaatacaacaaatggtg |
2003592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 89 - 143
Target Start/End: Complemental strand, 3633762 - 3633708
Alignment:
| Q |
89 |
gaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
3633762 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttt |
3633708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 10 - 121
Target Start/End: Complemental strand, 44521508 - 44521395
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||||||| |||||| || || ||||| ||||||||||||| || ||||||||||| || |||||||||||||| |||| |||||||| ||| || |
|
|
| T |
44521508 |
aaaggtcacgcgttcaaatcttggaaacaatctcttgtgtaaaaaacaaggtaaggctgcatataatacaccaaatggcgggagcccttcccagacattg |
44521409 |
T |
 |
| Q |
108 |
catatgcgggagct |
121 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
44521408 |
catatacgggagct |
44521395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 10 - 131
Target Start/End: Complemental strand, 31821476 - 31821355
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||||| ||||||||| | |||||||| ||| |||| ||||||||| || ||||||||||||||||| ||||||||||| ||| | |||| |
|
|
| T |
31821476 |
aaaggtcacgagttcaagtcgtagaaacagccgtgtgtaaaaaatagggtaaggttgtgtacaatacaccaaatgatgggacccctttccgaaacctgtg |
31821377 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcacc |
131 |
Q |
| |
|
|||||||||||| || |||||| |
|
|
| T |
31821376 |
tatgcgggagctttaatgcacc |
31821355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 50 - 131
Target Start/End: Complemental strand, 39499323 - 39499242
Alignment:
| Q |
50 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
131 |
Q |
| |
|
|||| ||||||| ||||||||||||||| |||||||||||| ||||| || | ||||| |||||||||||| ||||||||| |
|
|
| T |
39499323 |
aaaatagggtaaagctgcgtacaatacatcaaatggtgggatcccttttcgaatcctgcgtatgcgggagctttagtgcacc |
39499242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 95 - 143
Target Start/End: Original strand, 22371199 - 22371247
Alignment:
| Q |
95 |
ttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
22371199 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
22371247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 81 - 143
Target Start/End: Original strand, 1289095 - 1289158
Alignment:
| Q |
81 |
aatggtgggaccccttcccggaccctgcatatgcgggagc-tctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||| | ||||||||||| ||||||||| |
|
|
| T |
1289095 |
aatggtgggaccccttcccggatcatgcatatgcgggagcttttagtgcaccggattgcccttt |
1289158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 73 - 140
Target Start/End: Original strand, 31525771 - 31525838
Alignment:
| Q |
73 |
atacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccc |
140 |
Q |
| |
|
|||||||||||| |||||||| || || ||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
31525771 |
atacaccaaatgatgggaccctttgccagaccctgcatatgcgggagctttagtgtaccggattgccc |
31525838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 10 - 140
Target Start/End: Complemental strand, 45235953 - 45235820
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca---gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
106 |
Q |
| |
|
|||| ||||| ||||||||||| |||||| ||||| ||||||| | |||||||||| ||| ||||||| ||||||||||||||||| || |||||| |
|
|
| T |
45235953 |
aaagatcacgagttcaagtcctagaaacagtctcttctgtaaaataatagggtaaggctacgtgtaatacacaaaatggtgggaccccttaccagaccct |
45235854 |
T |
 |
| Q |
107 |
gcatatgcgggagctctagtgcaccgggttgccc |
140 |
Q |
| |
|
| ||||| |||||| ||||| ||| ||||||| |
|
|
| T |
45235853 |
acgtatgcaggagctttagtgtaccaagttgccc |
45235820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 82
Target Start/End: Complemental strand, 29420024 - 29419946
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgt--aaaacagg----gtaaggctgcgtacaatacaccaaa |
82 |
Q |
| |
|
|||||||||| |||||||||||| ||||| |||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
29420024 |
aaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagtaaggctgcgtacaatacaccaaa |
29419946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 73 - 135
Target Start/End: Original strand, 31523296 - 31523358
Alignment:
| Q |
73 |
atacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggt |
135 |
Q |
| |
|
|||||||||||||||| |||| ||||| |||||||||||||||||||| |||||||| |||| |
|
|
| T |
31523296 |
atacaccaaatggtggaaccctttcccaaaccctgcatatgcgggagctttagtgcactgggt |
31523358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 25 - 121
Target Start/End: Complemental strand, 30864536 - 30864439
Alignment:
| Q |
25 |
aagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
121 |
Q |
| |
|
||||| || |||||||||||||||||||| ||||||||| ||||||||||| |||||||||| || || ||||| ||||||| ||||||| |||| |
|
|
| T |
30864536 |
aagtcatggaaacagcctcttgtgtaaaaatagggtaagggtgcgtacaatataccaaatggtaagatcctttcccaaaccctgcgtatgcggaagct |
30864439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 95 - 139
Target Start/End: Complemental strand, 124962 - 124918
Alignment:
| Q |
95 |
ttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
139 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
124962 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
124918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 72 - 127
Target Start/End: Complemental strand, 24059067 - 24059012
Alignment:
| Q |
72 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
127 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||| |||| ||||||| ||||| |
|
|
| T |
24059067 |
aatacaccatatggtgggacccctttccggaccctgcgtatgtgggagctttagtg |
24059012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 12315786 - 12315697
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcc |
98 |
Q |
| |
|
|||||||||| ||||||||| || ||||||| |||| | |||| ||||||||| ||| |||||||||||||||| ||| ||| |||||| |
|
|
| T |
12315786 |
aaaggtcacgagttcaagtcatggaaacagcttcttattaaaaaacagggtaagactgtgtacaatacaccaaatagtgagactccttcc |
12315697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 80 - 144
Target Start/End: Complemental strand, 19185806 - 19185742
Alignment:
| Q |
80 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||||||||| ||||||||| ||||||||| |||||||||||| |||| || || ||| ||||||| |
|
|
| T |
19185806 |
aaatggtggaaccccttcctggaccctgcgtatgcgggagctttagtacatcgagttacccttta |
19185742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 62
Target Start/End: Original strand, 44604855 - 44604907
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgt-aaaacagggtaag |
62 |
Q |
| |
|
|||||||| ||||||||||||| ||||| |||||||||| ||||||||||||| |
|
|
| T |
44604855 |
aaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaacagggtaag |
44604907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 74 - 102
Target Start/End: Original strand, 4252656 - 4252684
Alignment:
| Q |
74 |
tacaccaaatggtgggaccccttcccgga |
102 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4252656 |
tacaccaaatggtgggaccccttcccgga |
4252684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 64 - 143
Target Start/End: Original strand, 4795810 - 4795890
Alignment:
| Q |
64 |
ctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||| |||||||||||| |||||||||| |||||||||| || ||||| | |||| ||||||| |||||||||||| |
|
|
| T |
4795810 |
ctgcgtgcaatacaccaaaatggtgggaccttttcccggaccttgtgtatgccgaagctttagtgcagtgggttgcccttt |
4795890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 19 - 143
Target Start/End: Complemental strand, 48758 - 48634
Alignment:
| Q |
19 |
gggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggga |
118 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48758 |
gggttcaagtggtggaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggga |
48659 |
T |
 |
| Q |
119 |
gctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48658 |
gctctagtgcaccgggttgcccttt |
48634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 10 - 144
Target Start/End: Original strand, 11131 - 11265
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11131 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacaaagtaaggctgcttacaatacaccaaatggtgggacaccttcccggaccctgca |
11230 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
11231 |
tatgcgggagctctagtgcaccaggttgcccttta |
11265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 10 - 141
Target Start/End: Complemental strand, 10183 - 10052
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10183 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagagtaagactgcgtacaatacaccaaatagtgggaccccttcccggaccctgca |
10084 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgccct |
141 |
Q |
| |
|
||||| ||||||| |||||||||||||||||| |
|
|
| T |
10083 |
tatgcaggagctccagtgcaccgggttgccct |
10052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 10 - 141
Target Start/End: Complemental strand, 20511 - 20380
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20511 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacagagtaagactgcgtacaatacaccaaatagtgggaccccttcccggaccctgca |
20412 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgccct |
141 |
Q |
| |
|
||||| ||||||| |||||||||||||||||| |
|
|
| T |
20411 |
tatgcaggagctccagtgcaccgggttgccct |
20380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 96; Significance: 4e-47; HSPs: 4)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 46832 - 46966
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46832 |
aaggtcacgggttcaagtgctggaaacaacctcttgtgtaaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
46931 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
46932 |
gtatgcgggagctttagtgcaccgggttgcccttt |
46966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 23 - 143
Target Start/End: Original strand, 43672 - 43793
Alignment:
| Q |
23 |
tcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggacccc-ttcccggaccctgcatatgcgggagct |
121 |
Q |
| |
|
|||||| ||| ||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
43672 |
tcaagttctggaaacagcgtcttgtgtaaaacaaggtaaggctgcgtacaatacaccaaatggtgggacccctttctcggaccctgcatatgcgggagct |
43771 |
T |
 |
| Q |
122 |
ctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||| | |||||||||| |
|
|
| T |
43772 |
ctagtgcactgagttgcccttt |
43793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #3
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 24902 - 24772
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
107 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
24902 |
aaaggtcatgggttcaagtc-----aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaacacaccaaatggtgggaccccttcccgaaccctg |
24808 |
T |
 |
| Q |
108 |
catatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
| |||||||||||| ||||||| | ||||||||||| |
|
|
| T |
24807 |
cgtatgcgggagctttagtgcagccggttgcccttt |
24772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 55 - 121
Target Start/End: Complemental strand, 46796 - 46729
Alignment:
| Q |
55 |
agggtaaggctgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagct |
121 |
Q |
| |
|
||||||||| ||| ||||||| |||||| ||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
46796 |
agggtaaggatgcatacaatataccaaaatggtgggaccccttcccagaccctgcgtatgcgggagct |
46729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 10 - 144
Target Start/End: Complemental strand, 1720 - 1586
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgca |
109 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
1720 |
aaaggtcatgggttcaagtcctgaaaacaacctcttgtgtaaaacaggataaggctgcatacaatacaccaaatgatgggaccccttcccggacccggcg |
1621 |
T |
 |
| Q |
110 |
tatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
|||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
1620 |
tatgcgggagctttagtgcaccaggttgcctttta |
1586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 91; Significance: 4e-44; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 13158 - 13024
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||| |||||| || ||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
13158 |
aaaggtcaccggttcaagtcctggaaacagcctcttgcgtaaaaacaaggtaaggctgcgtacaatacaccgaatggtgggaccccttcccagaccctgc |
13059 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||| |
|
|
| T |
13058 |
gtatgcgggggctttagtgcaccgggttgcccttt |
13024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 10811 - 10945
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
108 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||| ||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10811 |
aaggtcacgggttcaaggtctgaaaacaacctcttgtgtaaaaaacagggtagggctgcgtccaatacaccaaatggtgggaccccttcccggaccctgc |
10910 |
T |
 |
| Q |
109 |
atatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||| |||||||| ||||||| |||| |
|
|
| T |
10911 |
gtatgcgggagctttagtgcactgggttgctcttt |
10945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 10 - 144
Target Start/End: Original strand, 58977 - 59115
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccc |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||| ||||||||| ||||||||||||||||||| ||||||||||||||||| ||| | |
|
|
| T |
58977 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaagactgcgtacaatacaccaaaaatggtgggaccccttcccagactc |
59076 |
T |
 |
| Q |
106 |
tgcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
59077 |
tgcgtatgcgggagctttagtgcatcgggttgcccttta |
59115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 56 - 143
Target Start/End: Complemental strand, 24220 - 24133
Alignment:
| Q |
56 |
gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24220 |
gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgcccttt |
24133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 14 - 143
Target Start/End: Complemental strand, 72999 - 72867
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaaca-gcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcat |
110 |
Q |
| |
|
|||||||||||||||||| ||||| | ||||||||||||| || ||||||||||| |||||||||||||||||| | ||||||||||||| ||||| | |
|
|
| T |
72999 |
gtcacgggttcaagtcctagaaacaagtctcttgtgtaaaaaacacggtaaggctgcctacaatacaccaaatggtagtaccccttcccggaacctgcgt |
72900 |
T |
 |
| Q |
111 |
atgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| |
|
|
| T |
72899 |
atgcgggagctttagtgcaccaggttgcccttt |
72867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 11 - 98
Target Start/End: Complemental strand, 35152 - 35062
Alignment:
| Q |
11 |
aaggtcacgggttcaagtcctgaaaacagcctcttgtgt---aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35152 |
aaggtcacgggttcaagtcctgaaaacagtctcttgtgtgtgaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccctttcc |
35062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0954 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0954
Description:
Target: scaffold0954; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 26 - 144
Target Start/End: Original strand, 3560 - 3680
Alignment:
| Q |
26 |
agtcctgaaaacagcctcttgtgtaaaacag--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctct |
123 |
Q |
| |
|
||||||| ||| |||||||||||||||| | |||||||||||||| |||||||| |||| ||||||||||||||| ||||||| ||||||| |||| | |
|
|
| T |
3560 |
agtcctggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagcttt |
3659 |
T |
 |
| Q |
124 |
agtgcaccgggttgcccttta |
144 |
Q |
| |
|
||||||||| ||| ||||||| |
|
|
| T |
3660 |
agtgcaccgagtttcccttta |
3680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 10 - 106
Target Start/End: Original strand, 4157 - 4258
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaa--acagggtaaggctgcgtacaatacacc---aaatggtgggaccccttcccggacc |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||| ||||| ||||| ||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
4157 |
aaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataattggtgggaccccttcccggacc |
4256 |
T |
 |
| Q |
105 |
ct |
106 |
Q |
| |
|
|| |
|
|
| T |
4257 |
ct |
4258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0167 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0167
Description:
Target: scaffold0167; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 17 - 121
Target Start/End: Original strand, 23606 - 23712
Alignment:
| Q |
17 |
acgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgc |
114 |
Q |
| |
|
||||||||||||| || ||||| |||||||||||||| |||||| |||||||||||||| | ||||||||||||||||||||| |||| || |||| |
|
|
| T |
23606 |
acgggttcaagtcttgcaaacaacctcttgtgtaaaaaacagggtgaggctgcgtacaatgtagcaaatggtgggaccccttcccagaccttgagtatgt |
23705 |
T |
 |
| Q |
115 |
gggagct |
121 |
Q |
| |
|
||||||| |
|
|
| T |
23706 |
gggagct |
23712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 10 - 92
Target Start/End: Complemental strand, 226541 - 226456
Alignment:
| Q |
10 |
aaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa---cagggtaaggctgcgtacaatacaccaaatggtgggacc |
92 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| ||||| |||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
226541 |
aaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacagggtaaggctgcatacaatacatcaaatggtgggacc |
226456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0867 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0867
Description:
Target: scaffold0867; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 14 - 127
Target Start/End: Complemental strand, 3798 - 3685
Alignment:
| Q |
14 |
gtcacgggttcaagtcctgaaaacagcctcttgtgtaaa-acagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatat |
112 |
Q |
| |
|
|||| |||||||||| ||||||||| || |||||||||| ||| ||||| | ||||||||||||||||||||||||||||| || | || | || |||| |
|
|
| T |
3798 |
gtcatgggttcaagttctgaaaacaacc-cttgtgtaaatacaaggtaacgttgcgtacaatacaccaaatggtgggacccttttctcgatcttgtatat |
3700 |
T |
 |
| Q |
113 |
gcgggagctctagtg |
127 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
3699 |
gcgggagctttagtg |
3685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 56 - 143
Target Start/End: Original strand, 24696 - 24783
Alignment:
| Q |
56 |
gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
143 |
Q |
| |
|
||||||| ||||||| |||||||||||| |||| |||||| || |||||||| ||| |||||||| |||||||| | ||||||||| |
|
|
| T |
24696 |
gggtaagactgcgtataatacaccaaatagtggaccccctttccagaccctgcgtatacgggagcttcagtgcacctgattgcccttt |
24783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 73 - 144
Target Start/End: Complemental strand, 58699 - 58629
Alignment:
| Q |
73 |
atacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttta |
144 |
Q |
| |
|
||||||| ||||||| ||||||||| ||||||||| |||||||||||||| ||||||| || ||||||||| |
|
|
| T |
58699 |
atacaccgaatggtgagaccccttctcggaccctgtgtatgcgggagctct-gtgcaccaggctgcccttta |
58629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University