View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4361_high_4 (Length: 284)
Name: NF4361_high_4
Description: NF4361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4361_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 55183837 - 55184104
Alignment:
| Q |
1 |
cacagaggtttcatgcaattgaaaatacaagaaatagaatgaaattagtaaccacttaccagcaaccagtatcccataagccgaggttgacgcacaatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
55183837 |
cacagaggtttcatgcaattgaaaatacaagaaatagaatgaaattagtaaccacttaccagcaaccagtatcccataagccgaggttgacgcacaacca |
55183936 |
T |
|
| Q |
101 |
cagttgcgctaaaattgtctcgcaaaccctaaatgaatcttgacgcagttcatgaaccttgaccattttcttgctctgcttctagcctcaaaaacctaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
55183937 |
cagttgcgctaaaattgtctcgcaaaccctaaatgaatcttgacgcagttcatgaaccttgaccattttcgtgctctgcttctagcctcaaaaacctaaa |
55184036 |
T |
|
| Q |
201 |
tcattcgttcaagtctcaatgctcttggtgttgggatgggctctatgtacagagacagcttctgttat |
268 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
55184037 |
tcattcgttcaagtctcgatgctcttggtgttgggatggactctatgtacagagacagcttctgttat |
55184104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University