View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4361_high_4_N (Length: 305)
Name: NF4361_high_4_N
Description: NF4361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4361_high_4_N |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 35557152 - 35556858
Alignment:
| Q |
1 |
gaatccaccacatttcgcatttgaatttgaatattgaagaagatgagtcaaggaagtggaggaggaggatcttcatcttctcactcagtagcctttcgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35557152 |
gaatccaccacatttcgcatttgaatttgaatattgaagaagatgagtcaaggaagtggaggaggaggatcttcatcttctcactcagtagcctttcgtg |
35557053 |
T |
 |
| Q |
101 |
tcatgcgactctgtcgtccatccttcaacgtcgaccctcctcttcgtatcgatcccgacgacctcttcgtcggtgaagatcacttcgatgatccctccgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35557052 |
tcatgcgactctgtcgtccatccttcaacgtcgaccctcctcttcgtatcgatcccgacgacctcttcgtcggtgaagaccacttcgatgatccctccgc |
35556953 |
T |
 |
| Q |
201 |
cccttcctcctccgacctcattgctcccgattccgatcccaattatcgcaatagattcctccttcaacacttctcagattccatgggtctctctg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35556952 |
cccttcctcctccgacctcattgctcccgattccgatcccaattatcgcaatagattcctccttcaacacttctcagattctatgggtctctctg |
35556858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University