View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4361_high_5 (Length: 254)
Name: NF4361_high_5
Description: NF4361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4361_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 42528199 - 42527955
Alignment:
| Q |
1 |
atctcccaattagcacaagtaccttgtgatataaaaactttaaacaacatccagataacaaacaaacaagcaagtaaaaggtaaacagaaagaaggacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42528199 |
atctcccaattagcacaagtaccttgtgatataaaaactttaaacaacatccagataacaaacaaacaagcaagtaaaaggtaaacagaaagaaggacct |
42528100 |
T |
|
| Q |
101 |
gagaacaaacaacgttgcaatgacagccatggttctataccaacc---ttatgtatatcatgacatctttctctcaagttctaaccactctcttagctag |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42528099 |
gagaacaaacaacgttgcaatgacagccatggttctataccaaccttattatgtatatcatgacatctttctctcaagttctaaccactctcttagctag |
42528000 |
T |
|
| Q |
198 |
aagtgagaaactatggaatctgttccttatttatttcttgtgtct |
242 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42527999 |
aagtgagcaactatggaatctgttccttatttatttcttgtgtct |
42527955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University