View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4362-Insertion-24 (Length: 226)
Name: NF4362-Insertion-24
Description: NF4362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4362-Insertion-24 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 226
Target Start/End: Complemental strand, 46708648 - 46708430
Alignment:
| Q |
8 |
cattaactgaattttgaggttgcttgaattgctcaatctcatataaaaattcggtgttgtgtctttttgcagttaaataaaagagagagtgtggtcgaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46708648 |
cattaactgaattttgaggttgcttgaattgctcaatctcatataaaaattcggtgttgtgtctttttgcagttaaataaaagagagagtgtggtcgaat |
46708549 |
T |
|
| Q |
108 |
gaagagaatgagagagacatggccagagggaagtacctttgttccttcaacaacactactctctttctttgccttttcaacattgccattgttgctctct |
207 |
Q |
| |
|
||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46708548 |
gaagatagtgagagagacatggccagagggaagtacctttgttccttcaacaacactactctctttctttgccttttcaacattgccattgttgctctct |
46708449 |
T |
|
| Q |
208 |
tcgtttttcgctctcttta |
226 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
46708448 |
tcgtttttcgctctcttta |
46708430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University