View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4362_low_3 (Length: 241)
Name: NF4362_low_3
Description: NF4362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4362_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 80 - 223
Target Start/End: Complemental strand, 45673212 - 45673066
Alignment:
| Q |
80 |
cctctcttcaataattttagattagtcacaaattaataataat---ggctcttgaaactgtggttttcccacaacaagatccattcacatatagttacaa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45673212 |
cctctcttcaataattttagattagtcacaaattaataataataatggctcttgaaactgtggttttcccacaacaagatccattcacatatagttacaa |
45673113 |
T |
 |
| Q |
177 |
agacaattacttcaactctttgaataatgactatgatcatcttcatg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45673112 |
agacaattacttcaactctttgaataatgactatgatcatcttcatg |
45673066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University