View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4364-Insertion-18 (Length: 248)
Name: NF4364-Insertion-18
Description: NF4364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4364-Insertion-18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 43 - 248
Target Start/End: Complemental strand, 40500198 - 40499988
Alignment:
| Q |
43 |
agttttaagccagaactcggacaaccgcgtaggctagctgggccttca----gcctatgtctcaatcttactatgagaaataatactctgctgtggacat |
138 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40500198 |
agttttaagcccgaactcgggcaaccgcgtaggctagctgagccttggataggcctatgtctcaatcttactatgagaaataatactctgctgtggacat |
40500099 |
T |
 |
| Q |
139 |
gatgttcagttctggtaatgcactaatgcacgtgggcatattatcagattagtttagttggctttgaccatcatacaa-tcatgctttgtttgatcagct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
40500098 |
gatgttcagttctggtaatgcactaatgcacgtgggcatattatcagattagtttagttggctttgaccatcatacaattcatgctttgtttgattagct |
40499999 |
T |
 |
| Q |
238 |
tccagaccaag |
248 |
Q |
| |
|
||||||||||| |
|
|
| T |
40499998 |
tccagaccaag |
40499988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University