View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4364-Insertion-19 (Length: 201)
Name: NF4364-Insertion-19
Description: NF4364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4364-Insertion-19 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 8 - 201
Target Start/End: Complemental strand, 24831434 - 24831241
Alignment:
| Q |
8 |
aaatgaaggcctgatcaactaccacttccaaatgagaggatcggagtaactaatggtggtaatcttcaacattttaacagattgagtgaaacagaaagga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24831434 |
aaatgaaggcctgatcaactaccacttccaaatgagaggatcggagtaactaacggtggtaatcttcaacattttaacagattgagtgaaacagaaagga |
24831335 |
T |
|
| Q |
108 |
ataatttgcaacctatcttggcattggtggtacaattgcttgcttgcttctatggaactttatgttcatatcataaaagtgtagccacttatta |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24831334 |
ataatttgcaacctatcttggcattggtggtacaattgcttgcttgcttctatggaactttatgttcatatcataaaagcgtagccacttatta |
24831241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 147 - 201
Target Start/End: Complemental strand, 16947478 - 16947424
Alignment:
| Q |
147 |
ttgcttgcttctatggaactttatgttcatatcataaaagtgtagccacttatta |
201 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
16947478 |
ttgcttgcttctatagaactttatgttcatatcatgcaagcatagccacttatta |
16947424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University