View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4364_high_5 (Length: 345)
Name: NF4364_high_5
Description: NF4364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4364_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 13383067 - 13382801
Alignment:
| Q |
1 |
ggcaaaggagatcgtgtcttccaatcccgtcgttgttttcaggtaaatcgttttctctcattacttcatctttttt--ctgttgattcattgtttgtaat |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |||||| |||||| ||||||||| |||||||||||| |
|
|
| T |
13383067 |
ggcaaaggagatcgtgtcttccaatcccgtcgtcgttttcaggtaaatccttttctctcattccttcattttttttttctgttgatttattgtttgtaat |
13382968 |
T |
 |
| Q |
99 |
aataacaacgctgatttgtttaattcggtgattgattgattgattgaa---nnnnnnngcagtaaaagctattgtcccttttgcgttcaagtgaagaaac |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13382967 |
aataacaacgctgatttgtttaattcggtgattgattgattgattgaattttttttcttcagcaaaagctattgtcccttttgcgttcaagtgaagaaac |
13382868 |
T |
 |
| Q |
196 |
tcttcactgatttgggtgtcactttcaaagccgttgaactcgattctgaatgtaagtgctttcacat |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13382867 |
tcttcactgatttgggtgtcactttcaaagccgttgaactcgattctgaatgtaaatgctttcacat |
13382801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University