View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4364_high_8 (Length: 309)
Name: NF4364_high_8
Description: NF4364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4364_high_8 |
 | |
|
| [»] scaffold0031 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 2 - 304
Target Start/End: Complemental strand, 51226626 - 51226324
Alignment:
| Q |
2 |
gttgttttggttgttttgggatattttttacctcttttagttggaactggtgctgttgaagttaatagagagttatggagtgatggttacttttcagaag |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51226626 |
gttgttttggttgttttgggatattttttacctcttttagttggaactggtgctgttgaagttaatagagagttatggagtgatggttacttttcagaag |
51226527 |
T |
|
| Q |
102 |
ttggtagagttattggaggtgtttggttaagaacatgggttcaagttgcatcagctttatcaaatatgggaatgtttgtagctgagatgagtagtgactc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51226526 |
ttggtagagttattggaggtgtttggttaagaacatgggttcaagttgcatcagctttatcaaatatgggaatgtttgtagctgagatgagtagtgactc |
51226427 |
T |
|
| Q |
202 |
atttcagcttctaggtatggctgaaagaggtatgcttcctgaattctttgcaaaaaggtcacgttatggaacacctcttattggtattttgttctctgct |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
51226426 |
atttcagcttctaggtatggctgaaagaggtatgcttcctgaattctttgcaaaaaggtcacgttatggaacacctcttattggtattttgttctcagct |
51226327 |
T |
|
| Q |
302 |
tct |
304 |
Q |
| |
|
||| |
|
|
| T |
51226326 |
tct |
51226324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 164 - 261
Target Start/End: Complemental strand, 42095 - 41998
Alignment:
| Q |
164 |
aatatgggaatgtttgtagctgagatgagtagtgactcatttcagcttctaggtatggctgaaagaggtatgcttcctgaattctttgcaaaaaggtc |
261 |
Q |
| |
|
||||||||| ||||||| ||||| ||||| |||||||||||||||||||| |||||||| || || ||| | ||||| |||||| | |||||||| |
|
|
| T |
42095 |
aatatgggattgtttgttgctgaaatgagcgccgactcatttcagcttctaggaatggctgagaggggaatgttgcctgagttctttaccaaaaggtc |
41998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University