View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4364_low_2 (Length: 255)
Name: NF4364_low_2
Description: NF4364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4364_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 217
Target Start/End: Complemental strand, 31056369 - 31056167
Alignment:
| Q |
15 |
agtaccatcattcaagtagctggatttatttttaatcaatattggtggatgatttacaaatttttcacagatctgtatatataagtttgagcttaaagta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31056369 |
agtaccatcattcaagtagctggatttatttttaatcaatattggtggatgatttacaaatttttcacagatctgtatatataagtttgagcttaaagca |
31056270 |
T |
|
| Q |
115 |
aacaaacaataatcacgtggctatatgtgcgaatannnnnnnggtcatagtgggtagggtatgtgtgaatatgtgattacttttttcttttgacaggata |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31056269 |
aacaaacaataatcacgtggctatatgtgtgaatatttttttggtcatagtgggtagggtatgtgtgaatatgtgattacttttttcttttgactggata |
31056170 |
T |
|
| Q |
215 |
ata |
217 |
Q |
| |
|
||| |
|
|
| T |
31056169 |
ata |
31056167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 104
Target Start/End: Complemental strand, 31181886 - 31181799
Alignment:
| Q |
19 |
ccatcattcaagtagctggatttatttttaatcaatattggtggatgatttacaaatttttcacagatctgtata--tataagtttga |
104 |
Q |
| |
|
|||| |||||||||| |||||| ||| |||| ||||||| | ||||||||| ||||||||| |||||||||| ||||||||||| |
|
|
| T |
31181886 |
ccattattcaagtagatggattgttttctaatgaatattgttagatgatttatgaatttttcagggatctgtatatttataagtttga |
31181799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University