View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4365-Insertion-12 (Length: 228)
Name: NF4365-Insertion-12
Description: NF4365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4365-Insertion-12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 134632 - 134412
Alignment:
| Q |
7 |
aggagagactaggggcactatttattagtggtgggttggttggtttggtttcctctgaaggatatctatctttcttagattgttttcagttagtgttgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
134632 |
aggagagactaggggcactatttattagtggtgggttggttggtttggtttcctctgaaggatatctatctttcttagattgttttcagttagtgttgtt |
134533 |
T |
 |
| Q |
107 |
aaagaggccagcaccagcacggaggatatggttgtttgcatgagaagaagaagttgtcaataatgaattgaaagttaatattgtcggtgttgggccgaat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
134532 |
aaagaggccagcaccagcacggaggatatggttgtttgcatgagaagaagaagttgtcaataatgaattgaaagttaatattgtcggtgttgggccgaat |
134433 |
T |
 |
| Q |
207 |
taagaaggcagtgatgggtgg |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
134432 |
taagaaggcagtgatgggtgg |
134412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University