View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4365-Insertion-14 (Length: 201)

Name: NF4365-Insertion-14
Description: NF4365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4365-Insertion-14
NF4365-Insertion-14
[»] chr3 (1 HSPs)
chr3 (8-201)||(24831241-24831434)
[»] chr5 (1 HSPs)
chr5 (147-201)||(16947424-16947478)


Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 8 - 201
Target Start/End: Complemental strand, 24831434 - 24831241
Alignment:
8 aaatgaaggcctgatcaactaccacttccaaatgagaggatcggagtaactaatggtggtaatcttcaacattttaacagattgagtgaaacagaaagga 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
24831434 aaatgaaggcctgatcaactaccacttccaaatgagaggatcggagtaactaacggtggtaatcttcaacattttaacagattgagtgaaacagaaagga 24831335  T
108 ataatttgcaacctatcttggcattggtggtacaattgcttgcttgcttctatggaactttatgttcatatcataaaagtgtagccacttatta 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
24831334 ataatttgcaacctatcttggcattggtggtacaattgcttgcttgcttctatggaactttatgttcatatcataaaagcgtagccacttatta 24831241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 147 - 201
Target Start/End: Complemental strand, 16947478 - 16947424
Alignment:
147 ttgcttgcttctatggaactttatgttcatatcataaaagtgtagccacttatta 201  Q
    |||||||||||||| ||||||||||||||||||||  |||  |||||||||||||    
16947478 ttgcttgcttctatagaactttatgttcatatcatgcaagcatagccacttatta 16947424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University