View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4365-Insertion-16 (Length: 144)
Name: NF4365-Insertion-16
Description: NF4365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4365-Insertion-16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 5e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 5e-48
Query Start/End: Original strand, 6 - 126
Target Start/End: Complemental strand, 23036797 - 23036677
Alignment:
| Q |
6 |
cataatcatggtaagcgaattaactttccaaatacttcgaagaagaaaaactacttttcaaaagaaaaatttaggtgaatagttaaaatctgcttgcatc |
105 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |||||||||||| ||||| |
|
|
| T |
23036797 |
cataataatggtaagcgaattaactttccaaatacttcgaagaagaaaaactactttacaaaagaaaaatttagatgaataattaaaatctgctcgcatc |
23036698 |
T |
|
| Q |
106 |
ttatatctctactcggtagca |
126 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
23036697 |
ttatatctctactctgtagca |
23036677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University