View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4365_high_3 (Length: 207)

Name: NF4365_high_3
Description: NF4365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4365_high_3
NF4365_high_3
[»] chr7 (1 HSPs)
chr7 (14-189)||(22653433-22653608)


Alignment Details
Target: chr7 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 22653608 - 22653433
Alignment:
14 attatactcatttggttcaaatatccactcctttgccctattttgatcgggccgcgtacacggttcggttaatgggaattagggtttcggagaagttact 113  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||    
22653608 attatactcctttggttcaaatatccactcctttgccctattttgatcgggccgcgtacacagttcggttaatgggaattagggtttcagagaagttact 22653509  T
114 taatttgtctagtgatatgctcgctccagatcatactggagcaggtcaaactatgtttgatttaggtactcagttt 189  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||    
22653508 taatttgtctagtgatatgctcgctccagatcatactggagcgggtcaaactatgtttgatttgggtactcagttt 22653433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University