View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4365_low_4 (Length: 207)
Name: NF4365_low_4
Description: NF4365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4365_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 22653608 - 22653433
Alignment:
| Q |
14 |
attatactcatttggttcaaatatccactcctttgccctattttgatcgggccgcgtacacggttcggttaatgggaattagggtttcggagaagttact |
113 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22653608 |
attatactcctttggttcaaatatccactcctttgccctattttgatcgggccgcgtacacagttcggttaatgggaattagggtttcagagaagttact |
22653509 |
T |
 |
| Q |
114 |
taatttgtctagtgatatgctcgctccagatcatactggagcaggtcaaactatgtttgatttaggtactcagttt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
22653508 |
taatttgtctagtgatatgctcgctccagatcatactggagcgggtcaaactatgtttgatttgggtactcagttt |
22653433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University