View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4366-Insertion-3 (Length: 428)
Name: NF4366-Insertion-3
Description: NF4366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4366-Insertion-3 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 393; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 393; E-Value: 0
Query Start/End: Original strand, 7 - 428
Target Start/End: Original strand, 51222300 - 51222721
Alignment:
| Q |
7 |
attaagctctcttctaaaaagtgatttatggataagttttcgagatctcattgtatttttaataagtggcaaatagaatcgtccaagtgtatgataagat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51222300 |
attaagctctcttctaaaaagtgatttatggataagttttcgagatctcattgtattttttataagtggcaaatagaatcgtccaagtgtatgataagat |
51222399 |
T |
|
| Q |
107 |
agtcttttgggnnnnnnncccatgttttcagttggatgtatggttgattttgtcttttcattgtccattctctttgtcttttgagatgcggaagtgttgg |
206 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51222400 |
agtcttttggttttttcccccatgttttcagttggatgtatggttgattttgtcttttcattgtccattctctttgtcttttgagatgcggaagtgttgg |
51222499 |
T |
|
| Q |
207 |
taatttgaaagtcacaaaatggtgatattttctctcgtaagttggtgaatattgaggacttagtgaagcatattaatatctcttctcggaggtggatttc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51222500 |
taatttgaaagtcacaaaatggtgatattttctctcgtaagttggtgaatattgaggacttagtgaagcatattaatatctcttctcggaggtggatttc |
51222599 |
T |
|
| Q |
307 |
aggatattcttgtactttttatgagtggttaatggacctctcttagtgcatgcagagataatcttttggttgattcttcatgatttttggttggatttat |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51222600 |
aggatattcttgtactttttatgagtggttaatggacctctcttagtgcatgcagagataatcttttggttgattcttcatgatttttggttggatttat |
51222699 |
T |
|
| Q |
407 |
ggttgattttgtcttttcattg |
428 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
51222700 |
ggttgattttgtcttttcattg |
51222721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 137 - 175
Target Start/End: Original strand, 51222689 - 51222727
Alignment:
| Q |
137 |
gttggatgtatggttgattttgtcttttcattgtccatt |
175 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
51222689 |
gttggatttatggttgattttgtcttttcattgttcatt |
51222727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University