View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4367-Insertion-11 (Length: 95)
Name: NF4367-Insertion-11
Description: NF4367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4367-Insertion-11 |
 | |
|
| [»] chr4 (4 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 3e-39; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 3e-39
Query Start/End: Original strand, 6 - 95
Target Start/End: Complemental strand, 2019578 - 2019489
Alignment:
| Q |
6 |
cagattattcctgggaccaccttcatttgatggcatattgttggctatggtgttttgagatttaatatccattgttagcattttcgtaga |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2019578 |
cagattattcctgggaccaccttcatttgatggcatattgttggccatggtgttttgagatttaatctccattgttagcattttcgtaga |
2019489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 9e-30
Query Start/End: Original strand, 6 - 95
Target Start/End: Complemental strand, 2036307 - 2036218
Alignment:
| Q |
6 |
cagattattcctgggaccaccttcatttgatggcatattgttggctatggtgttttgagatttaatatccattgttagcattttcgtaga |
95 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||| | |||||||||||||||||| |||| |
|
|
| T |
2036307 |
cagattattgctgggaccaccttcatttgatagcatattgttggccatggtgttttgagatttattctccattgttagcattttcataga |
2036218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 61; E-Value: 9e-27
Query Start/End: Original strand, 6 - 90
Target Start/End: Complemental strand, 1990612 - 1990528
Alignment:
| Q |
6 |
cagattattcctgggaccaccttcatttgatggcatattgttggctatggtgttttgagatttaatatccattgttagcattttc |
90 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||| |||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
1990612 |
cagattatttctgggaccaccttcatttgatggcaaattgttggccatggtgttttgagatttattctccattgttaccattttc |
1990528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 56 - 95
Target Start/End: Complemental strand, 2022136 - 2022097
Alignment:
| Q |
56 |
tgttttgagatttaatatccattgttagcattttcgtaga |
95 |
Q |
| |
|
||||||||||| || | ||||||||||||||||||||||| |
|
|
| T |
2022136 |
tgttttgagatctattctccattgttagcattttcgtaga |
2022097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 54 - 95
Target Start/End: Original strand, 48204621 - 48204662
Alignment:
| Q |
54 |
ggtgttttgagatttaatatccattgttagcattttcgtaga |
95 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||| |||| |
|
|
| T |
48204621 |
ggtgttttgagatttattctccattgttagcattttcataga |
48204662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University