View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4367-Insertion-8 (Length: 149)
Name: NF4367-Insertion-8
Description: NF4367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4367-Insertion-8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 8 - 149
Target Start/End: Original strand, 51487125 - 51487266
Alignment:
| Q |
8 |
tgatgtggttaacaaattggagaaaacaaaggttactgattgcaaacttcctctccctttggttatgaatttgatatacttgtgtttcttgatatactgc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51487125 |
tgatgtggttaacaaattggagaaaacaaaggttactgattgcaaacttcctctccctttggttatgaatttgatatacttgtgtttcttgatatactgc |
51487224 |
T |
|
| Q |
108 |
tttgctctcaaaggcgttggtagattatatctcatgtacaca |
149 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
51487225 |
tttgctctcaaaggcattggtagattatatctcatgtacaca |
51487266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University