View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4367_low_6 (Length: 248)
Name: NF4367_low_6
Description: NF4367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4367_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 10421184 - 10421423
Alignment:
| Q |
1 |
caacttacaccatctaaactactctatacattgttgtaatctctaacatatgaatatccagatgacaagtaattcatctttttct--ttactagnnnnnn |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
10421184 |
caacttacaccatctaaactactctatacattgttgtaatctctaacatatgcatatccagatgacaagtaattcatctttctctctttactagtttttt |
10421283 |
T |
|
| Q |
99 |
nctttctcttataatttgggtgggatt-gatagataataaaatattgagtttaagctattagttcttggaaatctatgttatgcagtgctattgtaatat |
197 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10421284 |
tctttctcttataatttgggtgggatttgttagataataaaatattgagtttaaactattagttctttgaaatctatgttatgcagtgctattgtaatat |
10421383 |
T |
|
| Q |
198 |
tattgatattttgtgaacccttaaccgtctttgttagtat |
237 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10421384 |
tattgatattttatgaacccttaaccgtctttgttagtat |
10421423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University