View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4368_low_5 (Length: 227)
Name: NF4368_low_5
Description: NF4368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4368_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 37887890 - 37888097
Alignment:
| Q |
1 |
tatatattgttctttgctgaatcgtgttttaatagattagttactaatttcaatgtttgtaacttttgatgtgtggattatgtatatattaatatttcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37887890 |
tatatattgttctttgctgaatcgtgttttaatagattagttactaatttcaatgtttgtaacttttgatgtgtggattatgtatatattaatatttcac |
37887989 |
T |
|
| Q |
101 |
tttcctatactgcatatatttgttttggttaaataatgtgaagatttagatgtgattagaacccaattgaaatttgatcaaatctttgcatcttttgtta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37887990 |
tttcctatactgcatatatttgttttggttaaataatgtgaagatttagatgtgattagaacccaattgaaatttgatcaaatctttgcatcttttgtta |
37888089 |
T |
|
| Q |
201 |
attttata |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
37888090 |
attttata |
37888097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University